This file documents the networking features in GNU Awk (gawk)
version 3.1 and later.
gawk Networking Mechanisms
gawk
In May of 1997, Jürgen Kahrs felt the need for network access
from awk, and, with a little help from me, set about adding
features to do this for gawk (GNU Awk). At that time, he
wrote the bulk of this web page.
The code and documentation were added to the gawk 3.1 development
tree, and languished somewhat until I could finally get
down to some serious work on that version of gawk.
This finally happened in the middle of 2000.
In the meantime, Jürgen wrote an article about the Internet special
files and |& operator for Linux Journal, and made a
networking patch for the production versions of gawk
available from his home page.
In August of 2000, for gawk 3.0.6, this patch
also made it to the main GNU ftp distribution site.
For release with gawk, I edited Jürgen's prose for Texinfo
usage, as well as for English grammar and style, as he is not a native English
speaker. (In general, this wasn't major work.) I also
rearranged the material somewhat for what I felt was a better order of
presentation, and (re)wrote some of the introductory material.
The majority of this document and the code are his work, and the
high quality and interesting ideas speak for themselves. It is my
hope that these features will be of significant value to the awk
community.
Arnold Robbins
Nof Ayalon, ISRAEL
November, 2000
This chapter provides a (necessarily) brief intoduction to
computer networking concepts. For many applications of gawk
to TCP/IP networking, we hope that this will be enough. For more
advanced tasks, you will need deeper background, and it may be necessary
to switch to lower-level programming in C, C++, or perl.
There are two real-life models for the way computers send messages to each other over a network. While the analogies are not perfect, they are close enough to convey the major concepts. These two models are the phone system (reliable byte-stream communications), and the postal system (best-effort datagrams).
When you make a phone call, the following steps occur:
The same steps occur in a duplex reliable computer networking connection. There is considerably more overhead in setting up the communications, but once it's done, data moves in both directions, reliably, in sequence.
Suppose you mail three different documents to your office on the other side of the country on two different days. Doing so entails the following.
The important characteristics of datagram communications, like those of the postal system are thus:
The price the user pays for the lower overhead of datagram communications is exactly the lower reliability; it is often necessary for user-level protocols that use datagram communications to add their own reliabilty features on top of the basic communications.
The Internet Protocol Suite (usually referred as just TCP/IP)1 consists of a number of different protocols at different levels or "layers." For our purposes, three protocols provide the fundamental communications mechanisms. All other defined protocols are referred to as user-level protocols (e.g., HTTP, used later in this web page).
gawk for network programming.
All other user-level protocols use either TCP or UDP to do their basic communications. Examples are SMTP (Simple Mail Transfer Protocol), FTP (File Transfer Protocol) and HTTP (HyperText Transfer Protocol).
In the postal system, the address on an envelope indicates a physical location, such as a residence or office building. But there may be more than one person at the location; thus you have to further quantify the recipient by putting a person or company name on the envelope.
In the phone system, one phone number may represent an entire company, in which case you will need a person's extension number in order to reach that individual directly. Or, when you call a home, you have to say, "May I please speak to ..." before talking to the person directly.
IP networking provides the concept of addressing. An IP address represents a particular computer, but no more. In order to reach the mail service on a system, or the FTP or WWW service on a system, you have to have some way to further specify which service you want. In the Internet Protocol suite, this is done with port numbers, which represent the services, much like an extension number used with a phone number.
Port numbers are 16-bit integers. Unix and Unix-like systems reserve ports below 1024 for "well known" services, such as SMTP, FTP, and HTTP. Numbers above 1024 may be used by any application, although there is no promise made that a particular port number will always be available.
Two terms come up repeatedly when discussing networking: client and server. For now, we'll discuss these terms at the connection level, when first establishing connections between two processes on different systems over a network. (Once the connection is established, the higher level, or application level protocols, such as HTTP or FTP, determine who is the client and who is the server. Often, it turns out that the client and server are the same in both roles.)
The server is the system providing the service, such as the web server or email server. It is the host (system) which is connected to in a transaction. For this to work though, the server must be expecting connections. Much as there has to be someone at the office building to answer the phone2, the server process (usually) has to be started first and waiting for a connection.
The client is the system requesting the server. It is the system initiating the connection in a transaction. (Just as when you pick up the phone to call an office or store.)
In the TCP/IP framework, each end of a connection is represented by a pair
of (address, port) pairs. For the duration of the connection,
the ports in use at each end are unique, and cannot be used simultaneously
by other processes on the same system. (Only after closing a connection
can a new one be built up on the same port. This is contrary to the usual
behavior of fully developed web servers which have to avoid situations
in which they are not reachable. We have to pay this price in order to
enjoy the benefits of a simple communication paradigm in gawk.)
Furthermore, once the connection is established, communications are synchronous. I.e., each end waits on the other to finish transmitting, before replying. This is much like two people in a phone conversation. While both could talk simultaneously, doing so usually doesn't work too well.
In the case of TCP, the synchronicity is enforced by the protocol when sending data. Data writes block until the data have been received on the other end. For both TCP and UDP, data reads block until there is incoming data waiting to be read. This is summarized in the following table.
| TCP | X | X
|
| UDP | X |
|
| RAW | X |
|
gawk Networking MechanismsThe |& operator introduced in gawk 3.1 for use in
communicating with a co-process is described in
Two-way I/O.
It shows how to do two-way I/O to a
separate process, sending it data with print or printf, and
reading data with getline. If you haven't read it already, you should
detour there to do so.
gawk transparently extends the two-way I/O mechanism to simple networking through
the use of special file names. When a "co-process" is started that matches
the special files we are about to describe, gawk creates the appropriate network
connection, and then two-way I/O proceeds as usual.
At the C, C++ (and perl) level, networking is accomplished
via sockets, an Application Programming Interface (API) originally
developed at the University of California at Berkeley, and now used
almost universally for TCP/IP networking.
Socket level programming, while fairly straightforward, requires paying
attention to a number of details, and using binary data. It is not
well-suited for use from a high-level language like awk.
The special files provided in gawk hide the details from
the programmer, making things much simpler and easier to use.
The special file name for network access is made up of several fields, all of them mandatory, none of them optional:
/inet/protocol/localport/hostname/remoteport
The /inet/ field is of course constant when accessing the network.
The localport and remoteport fields do not have a meaning
when used with /inet/raw because "ports" only apply to
TCP and UDP. So, when using /inet/raw the port fields always have
to be 0.
Here, we will explain the meaning, the range of values and the defaults for all other fields.
All of the fields are mandatory. If you wish the system to pick a value,
or the field doesn't apply to the protocol, specify it as 0.
tcp, udp and raw. The exact meaning of each is
explained below. There is no default to this field.
/inet/raw and must therefore be 0. Application level clients
usually use 0 to indicate they do not bother which local port is
used. Instead they specify a remote port to connect to. It is vital for
application level servers to use a number different from 0 here
because their service has to be available at a specific publicly known
port number. It is possible to use a name from /etc/services here.
No default value is assumed. The value 0 means "any".
0 to indicate their being open for all other hosts
to connect to and enforce connection level server behavior this way.
It is not possible for an application level server to restrict its
availability to one remote host by entering a host name here.
Application level clients must enter a name different from 0 here.
The name can be either symbolic
(e.g., jpl-devvax.jpl.nasa.gov) or numeric (e.g., 128.149.1.143).
No default value is assumed. The value 0 means "any"
and enforces server behavior.
/inet/raw and must therefore be 0.
Application level clients must use a number
different from 0 here to indicate which port on the remote machine
they want to connect to. Application level servers must fill this field with
a 0. Instead they specify a local port for clients to connect to.
It is possible to use a name from /etc/services here.
No default value is assumed. The value 0 means "any" and enforces server
behavior.
Experts in network programming will notice that the usual
client/server asymmetry found at the level of the socket API is not visible
here. This is for the sake of simplicity of the high level concept. If you
really miss this, use another language like C, C++, or perl.
For gawk it is
more important to enable users to write a client program with a minimum
of code. What happens when first accessing a network connection can be seen
in the following pseudo-code:
if ((name of remote host given) && (other side accepts connection)) {
rendez-vous successful; transmit with getline or print
} else {
if ((other side did not accept) && (localport == 0))
exit unsuccessful
if (TCP) {
set up a server accepting connections
this means waiting for the client on the other side to connect
} else {
ready
}
}
The exact behavior of this algorithm depends on the values of the
fields of the special file name. When in doubt, use the following table that
gives you the combinations of values and their meaning. If you think this
table is too complicated, restrict yourself to the three lines printed in
bold letters. All the examples in
Using Networking from gawk,
use only the
patterns printed in bold letters.
| PROTOCOL | LOCAL PORT | HOST NAME | REMOTE PORT | RESULTING CONNECTION LEVEL BEHAVIOR
|
| tcp | 0 | x | x |
dedicated client, fails if immediately connecting to a
server on the other side fails
|
| udp | 0 | x | x | dedicated client
|
| raw | 0 | x | 0 | dedicated client, works only as root
|
| tcp, udp | x | x | x |
client, switches to dedicated server if necessary
|
| tcp, udp | x | 0 | 0 |
dedicated server
|
| raw | 0 | 0 | 0 | dedicated server, works only as root
|
| tcp, udp, raw | x | x | 0 | invalid
|
| tcp, udp, raw | 0 | 0 | x | invalid
|
| tcp, udp, raw | x | 0 | x | invalid
|
| tcp, udp | 0 | 0 | 0 | invalid
|
| tcp, udp | 0 | x | 0 | invalid
|
| raw | x | 0 | 0 | invalid
|
| raw | 0 | x | x | invalid
|
| raw | x | x | x | invalid
|
Now we will develop a pair of programs (sender and receiver) that do nothing but send a time stamp from one machine to another. We will implement the sender and the receiver with each of the three protocols available and discover the differences between them.
/inet/tcpOnce again, you should always use TCP. There are few circumstances that justify the use of UDP or RAW. We can take as an example the sender program, which is described in detail in Setting Up a Service.
# Server
BEGIN {
print strftime() |& "/inet/tcp/8888/0/0"
close("/inet/tcp/8888/0/0")
}
The receiver is almost identical to the first example in Establishing a TCP Connection. If you want this pair of scripts to exchange data, proceed as described there.
# Client
BEGIN {
"/inet/tcp/0/localhost/8888" |& getline
print $0
close("/inet/tcp/0/localhost/8888")
}
TCP guarantees that the bytes at the receiving end arrive in exactly the same order that they were sent. No byte will be lost (except for broken connections), no byte doubled, no byte out of order. Some overhead is necessary to accomplish this but this is the price we pay for a reliable service.
It does matter which side starts first. The sender/server has to be started first and will wait for the receiver to read a line.
/inet/udpBoth programs are almost identical to their TCP counterparts. Only the protocol has changed. As before, it does matter which side starts first. The receiving side will block and wait for the sender. So, in this case, the receiver/client has to be started first.
# Server
BEGIN {
print strftime() |& "/inet/udp/8888/0/0"
close("/inet/udp/8888/0/0")
}
The receiver is almost identical to the first example of this chapter:
# Client
BEGIN {
"/inet/udp/0/localhost/8888" |& getline
print $0
close("/inet/udp/0/localhost/8888")
}
UDP cannot guarantee that the datagrams at the receiving end arrive in exactly the same order that they were sent. Some datagrams could be lost, some doubled, and some out of order. But no overhead is necessary to accomplish this. This unreliable behavior is good enough for tasks like data acquisition, logging and even stateless services like NFS.
/inet/rawThis is an IP level protocol. Only root is allowed to access this
special file. It is meant to be the basis for implementing
and experimenting with transport level protocols.3
In the most general case,
the sender has to supply the encapsulating header bytes in front of the
packet and the receiver has to strip the additional bytes from the message.
RAW receivers cannot receive packets sent with TCP or UDP because the
operating system will not deliver the packets to a RAW receiver. The
operating system knows about some of the protocols on top of IP
and will decide on its own which packet to deliver to which process.
(d.c.)
See
Richard Stevens' home page and books. Therefore we have to use the UDP receiver for receiving UDP
datagrams sent with the RAW sender. This is a dark corner, not only of
gawk, but also of TCP/IP implementations.
If you are interested in playing with protocols, you will benefit from the
approach implemented in a tool called SPAK,
see.
This tool reflects the hierarchical layering of protocols (encapsulation)
in the way data streams are piped out of one program into the next one.
You can see which protocol is based on which other (lower level) protocol
by looking at the command line ordering of the program calls.
Cleverly thought out, SPAK will serve you much better than gawk's
/inet if you want to learn the meaning of each and every bit in the
protocol headers.
We will use the RAW protocol to emulate the behavior of UDP. The sender program is the same as above but with some additional bytes that fill the places of the UDP fields.
BEGIN {
Message = "Hello world\n"
SourcePort = 0
DestinationPort = 8888
MessageLength = length(Message)+8
RawService = "/inet/raw/0/localhost/0"
printf("%c%c%c%c%c%c%c%c%s",
SourcePort/256, SourcePort%256,
DestinationPort/256, DestinationPort%256,
MessageLength/256, MessageLength%256,
0, 0, Message) |& RawService
fflush(RawService)
close(RawService)
}
Since we try to emulate the behavior of UDP, we will check if
the RAW sender is understod by the UDP receiver but not if the RAW receiver
can understand the UDP sender (see above). In a real network, the
RAW receiver will hardly
be of any use because it gets every IP packet that
comes across the network. There will usually be so many packets that
gawk would be too slow for processing them.
Only on a network with little
traffic can you test the IP-level receiver program. Programs for analyzing
IP traffic on modem or ISDN channels should be possible.
Port numbers do not have a meaning when using /inet/raw. Their fields
have to be 0. Only TCP and UDP use ports. Receiving data from
/inet/raw is difficult not only because of processing speed but also
because data will usually be binary and not restricted to ASCII. This
implies that line separation with RS will not work as usual.
gawkThe awk programming language was originally developed as a
pattern-matching language for writing short programs to perform
data manipulation tasks. It was never meant to be used for networking
purposes. awk's strength is the manipulation of textual data
that is stored in files. If we want to exploit its features in a
networking context, we have to use an access mode for network connections
that resembles the access of files as closely as possible. Therefore
we have the following three special files (listed in descending order
of importance). These files let us use the protocols of the same name
for establishing connections.
/inet/tcp is used for reliable connections. When accessing this
special file, we initiate a connection that uses the TCP protocol; the
protocol that the WWW is based on. Using TCP involves some overhead
but novices as well as experts are well advised to use TCP
because it takes away most of the burdens of network programming.
/inet/udp is used for unreliable connections. When accessing this
special file, we initiate a connection that uses the UDP protocol; the
protocol that the traditional NFS file system is based on. UDP has
little overhead but it cannot guarantee reliability; therefore the
application level protocol (for example NFS) has to take care of
reliability.
/inet/raw is used for low level data transmission. When accessing
this special file, we are responsible for each and every bit that controls
IP network traffic. We are usually not interested in doing so, but it is
available for the sake of completeness. It can be interesting for those
who do experiments with protocols on top of IP and have root
privileges to do so.4
In this chapter, we will only demonstrate how to use the TCP protocol. The other protocols are much less important for most users (UDP) or even untractable (RAW).
awk is also meant to be a prototyping language. It is used
to demonstrate feasibility and to play with features and user interfaces.
This can be done with the above mentioned file-like handling of network
connections. For the convenience of simple handling, we trade the lack
of many of the advanced features of the TCP/IP family of protocols. Such
features are available when programming in C or perl. In fact, what we
do in this chapter
is very similar to what is described in books like
Internet Programming with Python and
Advanced Perl Programming or
Web Client Programming with Perl.
But we do it without first having to learn object oriented ideology, underlying
languages like Tcl/Tk, perl, Python, or all of the libraries necessary to
extend these languages before they are ready for the Internet.
Let us observe a network connection at work. Type in the following program
and watch the output. Within a second it connects via TCP (/inet/tcp)
to the machine it is running on (localhost) and asks the service
daytime on the machine what time it is.
BEGIN {
"/inet/tcp/0/localhost/daytime" |& getline
print $0
close("/inet/tcp/0/localhost/daytime")
}
Even experienced awk users will find the second line strange in two
respects:
getline. One would rather expect to see the special file
being read like any other file (getline <
"/inet/tcp/0/localhost/daytime").
|& has not been part of any awk
implementation (until now).
It is actually the only extension of the awk
language needed (apart from the special files) to introduce network access.
Arnold Robbins introduced the |& operator in order to
overcome the crucial restriction that access to files and pipes in
awk is always uni-directional. It was formerly impossible to use
both access modes on the same file or pipe. Instead of changing the whole
concept of file access, he decided to introduce the |& operator
which behaves exactly like the usual pipe operator except for two additions:
gawk program with a |&
pipe can be accessed bi-directionally. The |& turned out to be a quite
general, useful and natural extension of awk.
What happens in this program? The operator |& tells getline
to read a line from the special file /inet/tcp/0/localhost/daytime.
We could also have printed a line into the special file. But instead we just
read a line with the time, printed it and closed the connection.
(While we could just let gawk close the connection by finishing
the program, in this web page
we are pedantic, and always explicitly close the connections.)
It may well be that for some reason the above program does not run on your
machine. When looking at possible reasons for this you will learn much
about typical problems that arise in network programming. First of all
your implementation of gawk may not support network access because it is
a pre 3.1 version or you do not have a network interface in your machine.
Perhaps your machine uses some other protocol
like DECnet or Novell's IPX. For the rest of this chapter
we will assume
you work on a Unix machine that supports TCP/IP. If the above program does
not run on such a machine, it may help to replace the name
localhost with the name of your machine or its IP address. If it
does, you could replace localhost with the name of another machine
in your vicinity. This way, the program connects to another machine.
Now you should see the date and time being printed by the program.
Otherwise your machine may not support the daytime service.
Try changing the service to chargen or ftp. This way, the program
connects to other services that should give you some response. If you are
curious, you should have a look at your file /etc/services. It could
look like this:
# /etc/services: # # Network services, Internet style # # Name Number/Protcol Alternate name # Comments echo 7/tcp echo 7/udp discard 9/tcp sink null discard 9/udp sink null daytime 13/tcp daytime 13/udp chargen 19/tcp ttytst source chargen 19/udp ttytst source ftp 21/tcp telnet 23/tcp smtp 25/tcp mail finger 79/tcp www 80/tcp http # WorldWideWeb HTTP www 80/udp # HyperText Transfer Protocol pop-2 109/tcp postoffice # POP version 2 pop-2 109/udp pop-3 110/tcp # POP version 3 pop-3 110/udp nntp 119/tcp readnews untp # USENET News irc 194/tcp # Internet Relay Chat irc 194/udp ...
Here, you find a list of services that traditional Unix machines usually
support. If your GNU/Linux machine does not do so, it may be that these
services are switched off in some startup script. Systems running some
flavor of Microsoft Windows usually do not support such services.
Nevertheless, it is possible to do networking with gawk on
Microsoft Windows.
The first column of the file gives the name of the service,
the second a unique number and the protocol that one can use to connect to
this service.
The rest of the line is treated as a comment.
You see that some services (echo) support TCP as
well as UDP.
The next program makes use of the possiblity to really interact with a
network service by printing something into the special file. It asks the
so-called finger service if a user of the machine is logged in. When
testing this program, you should also try to change localhost to
some other machine name in your local network.
BEGIN {
NetService = "/inet/tcp/0/localhost/finger"
print "name" |& NetService
while ((NetService |& getline) > 0)
print $0
close(NetService)
}
After telling the service on the machine which user it is looking for,
the program repeatedly reads lines that come as a reply. When no more
lines are coming (because the service has closed the connection), the
program also closes the connection. Try replacing "name" by your
login name or the name of someone else logged in. If you want a list
of all users currently logged in, replace name by an empty string
"".
You could safely delete the final close command from
the above script because the operating system closes any open connection
by default when a script reaches the end of execution. In order to avoid
portability problems, we always close connections explicitly. With the
Linux kernel,
for example, proper closing results in flushing of buffers, while letting
the close happen by default may result in discarding buffers.
In the early days of the Internet (until around 1992), you could use
such a program to check if some user in another country was logged in on
a specific machine.
RFC 1288
will give you the exact definition of the finger protocol.
Every contemporary Unix system also has a command named finger,
which functions as a client for the protocol of the same name.
Still today, some people maintain simple information systems
with this ancient protocol. For example, by typing
finger quake@seismo.unr.edu [...] DATE-(UTC)-TIME LAT LON DEP MAG COMMENTS yy/mm/dd hh:mm:ss deg. deg. km 98/12/14 21:09:22 37.47N 116.30W 0.0 2.3Md 76.4 km S of WARM SPRINGS, NEVA 98/12/14 22:05:09 39.69N 120.41W 11.9 2.1Md 53.8 km WNW of RENO, NEVADA 98/12/15 14:14:19 38.04N 118.60W 2.0 2.3Md 51.0 km S of HAWTHORNE, NEVADA 98/12/17 01:49:02 36.06N 117.58W 13.9 3.0Md 74.9 km SE of LONE PINE, CALIFOR 98/12/17 05:39:26 39.95N 120.87W 6.2 2.6Md 101.6 km WNW of RENO, NEVADA 98/12/22 06:07:42 38.68N 119.82W 5.2 2.3Md 50.7 km S of CARSON CITY, NEVAD
you get the latest Earthquake Bulletin for the state of Nevada.
It contains time, location, depth, magnitude and a short comment about
the earth quakes registered in that region during the last 10 days.
In many places today the use of such services is restricted
because most networks have firewalls and proxy servers between themselves
and the Internet. Most firewalls are programmed to not let
finger requests go beyond the local network.
Another (ab)use of the finger protocol are several Coke machines
that are connected to the Internet. There is a short list of such
Coke machines.
You can access them either from the command line or with a simple
gawk script. They will usually tell you about the different
flavors of Coke and Beer available there. If you have an account there,
you can even order some drink this way.
When looking at /etc/services you may have noticed that the
daytime service is also available with udp. In the example
above change tcp to udp and finger to daytime.
After starting the example, you will see the expected day and time message
and then the program hangs because it waits for more lines coming from the
service, but they never come. This behavior is a consequence of the
differences between TCP and UDP. When using UDP, neither party is
automatically informed about the other closing the connection. When
continuing to experiment this way you will experience many other subtle
differences between TCP and UDP. To avoid such trouble one should always
remember the advice Comer and Stevens give in
Volume III of their series Internetworking With TCP (page 14):
When designing client-server applications, beginners are strongly advised to use TCP because it provides reliable, connection-oriented communication. Programs only use UDP if the application protocol handles reliability, the application requires harware broadcast or multicast, or the application cannot tolerate virtual circuit overhead.
The preceding programs behaved as clients which connected to a server somewhere
on the Internet and requested a certain service. Now we will set up such a
service ourselves which mimics the behavior of the daytime service.
Such a server does not know in advance who is going to connect to it over
the network. Therefore we cannot insert a name for the host to connect to
in our special file name.
Start the following program in one window. Notice
that our service does not have the name daytime but the number 8888.
From looking at /etc/services you know that names like daytime
are just mnemonics for predetermined 16 bit integers.
Only the system administrator (root) could enter
our new service into /etc/services with an appropriate name.
Also notice that the service name has to be entered into a different field
of the special file name because here we set up a server, not a client.
BEGIN {
print strftime() |& "/inet/tcp/8888/0/0"
close("/inet/tcp/8888/0/0")
}
Now open another window (on the same machine).
Copy the client program given as the first example
(see Establishing a TCP Connection)
to a new file and edit it, changing the name daytime to
8888. Then start the modified client. You should get a reply
like this:
Sat Sep 27 19:08:16 CEST 1997
Both programs will explicitly close the connection.
Now we will intentionally make a mistake to see what happens when the name
8888 (the so called port) is already used by another service. Start the server
program in both windows. The first one will work, but the second one will
complain that it could not open the connection. Each port on a single
machine can only be used by one server program at a time. Now terminate the
server program and change the name 8888 to echo. After restarting it,
the server program will not run any more and you know why: There already is
an echo service running on your machine. But even if there was no
echo service already running, on a Unix machine you would not get
your own echo server running, because the ports with numbers smaller
than 1024 (echo is at port 7) are reserved for root.
On machines running some flavor of Microsoft Windows, there is no restriction
that reserves ports 1 to 1024 for a privileged user and hence you can start
one echo server there.
Turning this short server program into something really useful is simple. Imagine a server that first reads a file name from the client through the network connection, then does something with the file of that name and finally sends the result back to the client. The server side processing could be
BEGIN {
NetService = "/inet/tcp/8888/0/0"
NetService |& getline
CatPipe = ("cat " $1)
while ((CatPipe | getline) > 0)
print $0 |& NetService
close(NetService)
}
and we would
have a remote copying facility. Such a server reads the name of a file
from any client that connects to it and transmits the contents of the
named file across the net. The server side processing could also be
the execution of a command that was transmitted across the network. From this
example you can see how simple it is to open up a security hole on your
machine. If you really allowed clients to connect to your machine and
execute arbitrary commands, anyone would be free to do rm -rf *.
Have you ever wondered what your email client does when it retrieves your email from the email server? In this section we will see.
The distribution of email is usually done by dedicated email servers that communicate with your machine using special protocols. To receive email, we will use the Post Office Protocol (POP) which is defined in RFC 1939. Sending can be done with the much older Simple Mail Transfer Protocol (SMTP) which is defined in RFC 821, see RFCs in HTML.
When you type in the following program, replace the emailhost by the name of your local email server. Ask your administrator if the server has a POP service and then replace its name or number in the program below. Now the program is ready to connect to your email server but it will not succeed in retrieving your mail because it does not yet know your login name and your password. Replace them in the program and the program will show you the first email the server has in store.
BEGIN {
POPService = "/inet/tcp/0/emailhost/pop3"
RS = ORS = "\r\n"
print "user name" |& POPService
POPService |& getline
print "pass password" |& POPService
POPService |& getline
print "retr 1" |& POPService
POPService |& getline
if ($1 != "+OK") exit
print "quit" |& POPService
RS = "\r\n.\r\n"
POPService |& getline
print $0
close(POPService)
}
The record separators RS and ORS are redefined because the
protocol (POP) requires CR-LF to separate lines. After identifying
yourself to the email service, the command retr 1 instructs the
service to send the first of all your emails in line. If the service
replies with something other than +OK, the program exits; maybe there
is no email. Otherwise the program first announces that it intends to finish
reading email and finally redefines RS in order to read the entire
email as multiline input in one record. From RFC 1939 we know that the body
of the email always ends with a single line containing a single dot.
You can invoke this program as often as you like; it will not delete the
message it reads, but instead leaves it on the server.
Could it be that retrieving a web page from a web server is as simple as retrieving an email from an email server? Yes, it is. We only have to use a similar but not identical protocol and a different port. The name of the protocol is HyperText Transfer protocol (HTTP) and the port number usually is 80. As in the preceding section, ask your administrator about the name of your local web server or proxy web server and its port number for HTTP requests.
More detailed information about HTTP can be found at the home of the web protocols including the specification of HTTP in RFC 2068. The protocol specification in RFC 2068 is concise and you can get it for free. If you need more explanation and you are willing to pay for a book, you might be interested in one of these books:
gawk,
the only book available with details about HTTP was the one by Paul Hethmon
called Illustrated Guide to HTTP. Hethmon not only describes HTTP,
he also implements a simple web server in C++.
The following program employs a rather crude approach toward retrieving a
web page because it uses the prehistoric syntax of HTTP 0.9 which almost all
web servers still support. The most noticeable thing about it is that the
program directs the request to the local proxy server whose name you insert
in the special file name (which in turn calls www.yahoo.com).
BEGIN {
RS = ORS = "\r\n"
HttpService = "/inet/tcp/0/proxy/80"
print "GET http://www.yahoo.com" |& HttpService
while ((HttpService |& getline) > 0)
print $0
close(HttpService)
}
Here, again, lines are separated by a redefined RS and ORS.
The GET request that we send to the server is the only kind of
HTTP request that existed when the web was created in the early 1990's.
HTTP calls this GET request a "method" that tells the
service to transmit a web page (here the home page of the Yahoo search
engine). Version 1.0 (RFC 1945) added the request methods HEAD
and POST. The current version of HTTP is 1.15
and knows the
additional request methods OPTIONS, PUT, DELETE,
and TRACE.
You can fill in any valid web address and the program will print the
HTML code of that page to your screen.
Notice the similarity between the responses of the POP and HTTP services. First you get a header that is terminated by an empty line and then you get the body of the page in HTML. The lines of the headers also have the same form as in POP. First there is the name of a parameter, then a colon and finally the value of that parameter.
You can also retrieve images (.png or .gif files) this way,
but then you
will get binary data that should be redirected into a file. Another
application is calling a CGI (Common Gateway Interface) script on some
server. CGI scripts are used when the contents of a web page are not
constant but generated instantly at the moment you send a request
for the page. For example, to get a detailed report about the current
quotes of Motorola stock shares, call a CGI script at Yahoo with:
get = "GET http://quote.yahoo.com/q?s=MOT&d=t" print get |& HttpService
You could also call for weather reports this way. A good book to go on with is the HTML Source Book. There are also some books on CGI programming like the one by Thomas Boutell and this one. Another good source is The CGI Resource Index.
Now we know enough about HTTP to set up a primitive web service that just
says "Hello world" when someone connects to it with a web browser.
Compared
to the situation in the preceding section, our program changes the role. It
tries to behave just like the server we have observed. Since we are setting
up a server here, we have to insert the port number in the localport
field of the special file name. The other two fields (hostname and
remoteport) have to contain a 0 because we do not know in
advance which host will connect to our service.
In the early 1990's all a server had to do was send an HTML document and close the connection. Here we will adhere to the modern syntax of HTTP. The steps are:
"Hello world" body
in HTML. The useless while loop swallows the request of the browser.
We could actually omit the loop and on most machines the program would still
work.
To check this one out, first start the following program.
BEGIN {
RS = ORS = "\r\n"
HttpService = "/inet/tcp/8080/0/0"
Hello = "<HTML><H1>Hello world</H1></HTML>"
Len = length(Hello) + length(ORS)
print "HTTP/1.0 200 OK" |& HttpService
print "Content-Length: " Len ORS |& HttpService
print Hello |& HttpService
while ((HttpService |& getline) > 0)
continue;
close(HttpService)
}
Now (on the same machine) start your favorite browser and let it point to
<http://localhost:8080>. You see, the browser needs to know on which port
our server is listening for requests. If this does not work, the browser
probably tries to connect to a proxy server which does not know your machine.
Then, change the browser's configuration so that the browser will not try to
use a proxy to connect to your machine.
Setting up a web service that allows user interaction is more difficult and
leads us to the limits of network access in gawk. In this section,
we develop a main program (a BEGIN pattern and its action)
that will become the core of event-driven execution controlled by a
graphical user interface (GUI).
Each HTTP event that the user triggers by some action within the browser
will be received in this central procedure. Parameters and menu choices are
extracted from this request and an appropriate measure is taken according to
the user's choice.
BEGIN {
if (MyHost == "") {
"uname -n" | getline MyHost
close("uname -n")
}
if (MyPort == 0) MyPort = 8080
HttpService = "/inet/tcp/" MyPort "/0/0"
MyPrefix = "http://" MyHost ":" MyPort
SetUpServer()
while ("Perl" != "elegant") {
RS = ORS = "\r\n" # header lines are terminated this way
Status = 200 # this means OK
Reason = "OK"
Header = TopHeader
Document = TopDoc
Footer = TopFooter
if (GETARG["Method"] == "GET") { HandleGET()
} else if (GETARG["Method"] == "HEAD") { # not yet implemented
} else if (GETARG["Method"] != "") { print "bad method",GETARG["Method"]
}
Prompt = Header Document Footer
print "HTTP/1.0", Status, Reason |& HttpService
print "Connection: Close" |& HttpService
print "Pragma: no-cache" |& HttpService
print "Content-length:", length(Prompt) + length(ORS) |& HttpService
print ORS Prompt |& HttpService
while ((HttpService |& getline) > 0) ; # ignore all the header lines
close(HttpService) # stop talking to this client
HttpService |& getline # wait for new client request
print systime(), strftime(), $0 # do some logging
CGI_setup($1, $2, $3) # read request parameters
}
}
This web server presents menu choices in the form of HTML links.
Therefore, it has to tell the browser the name of the host it is
residing on. When starting the server, the user may supply the name
of the host from the command line with gawk -v MyHost="Rumpelstilzchen".
If he does not do this, the server looks up the name of the host it is
running on for later use as a web address in HTML documents. The same
applies to the port number. These values will later be inserted into the
HTML content of the web pages to refer to the home system.
Each server that we will build around this core has to initialize some
application dependent variables (like the default home page) in a procedure
SetUpServer, which will be called immediately before entering the
infinite loop of the server. For now, we will write an instance that
initiates a trivial interaction. With this home page, the client user
can click on two possible choices and will get the current date either
in human readable format or in seconds since 1970.
function SetUpServer() {
TopHeader = "<HTML><title>My name is GAWK, GNU AWK</title></HEAD>"
TopDoc = "<h2>\
Do you prefer your date <A HREF=" MyPrefix "/human>human</A> or\
<A HREF=" MyPrefix "/POSIX>POSIXed</A>?</h2>" ORS ORS
TopFooter = "</BODY></HTML>"
}
On the first run through the main loop, the default line terminators are
set and the default home page is copied to the actual home page. Since this
is the first run, GETARG["Method"] is not initialized yet, hence the
case selection over the method does nothing. Now that the home page is
initialized, the server can start communicating to a client browser.
It does so by printing the HTTP header into the network connection
(print ... |& HttpService). This command blocks execution of
the server script until a client connects. If you compare this server
script with the primitive one we wrote before, you will notice
two additional lines in the header. The first instructs the browser
to close the connection after each request. The second one tells the
browser that it should never try to remember earlier requests
that had identical web addresses (no caching). Otherwise it could happen
that the browser retrieves the time of day in the example above just once
and later it takes the web page from the cache, always displaying the same
time of day, although time advances each second.
Having supplied the initial home page to the browser with a valid document
stored in the parameter Prompt, it closes the connection and waits
for the next request. When the request comes, a log line is printed that
allows us to see which request the server receives. The final step in the
loop is to call the function CGI_setup which reads all the lines
of the request (coming from the browser), processes them and stores the
transmitted parameters. You will find the complete text of these application
independent functions in A Simple CGI Library. For now we will use
a simplified version of CGI_setup.
function CGI_setup( method, uri, version, i) {
delete GETARG; delete MENU; delete PARAM
GETARG["Method"] = $1; GETARG["URI"] = $2; GETARG["Version"] = $3
i = index($2, "?")
if (i > 0) { # is there a "?" indicating a CGI request?
split(substr($2, 1, i-1), MENU, "[/:]")
split(substr($2, i+1), PARAM, "&")
for (i in PARAM) {
j = index(PARAM[i], "=")
GETARG[substr(PARAM[i], 1, j-1)] = substr(PARAM[i], j+1)
}
} else { # there is no "?", no need for splitting PARAMs
split($2, MENU, "[/:]")
}
}
At first, the function clears all variables that are used for
global storage of request parameters. The rest of the function serves
the purpose of filling the global parameters with the extracted new values.
To accomplish this, the name of the requested resource is split into
parts and stored for later evaluation. If the request contains a ?,
then the request has CGI variables seamlessly appended to the web address.
Everything in front of the ? is split up into menu items and
everything behind the ? is a list of variable=value pairs
(separated by &) that also need splitting. This way, CGI variables are
isolated and stored. This procedure lacks recognition of special characters
that are transmitted in coded form (as defined in RFC 2068). Here, any
optional request header and body parts are ignored. We do not need
header parameters and the request body, but when refining our approach or
working with the POST and PUT methods, reading the header
and body will
become inevitable. Header parameters should then be stored in a global
array as well as the body.
On each subsequent run through the main loop, one request from a browser is
received, evaluated and answered according to the user's choice. This can be
done by letting the value of the HTTP method guide the main loop into
execution of the procedure HandleGET which evaluates the user's
choice. In this case, we have only one hierarchical level of menus, but
menus are nested in the general case. The menu choices at each level are
separated by / just like in file names. Notice how simple it is to
construct menus of arbitrary depth.
function HandleGET() {
if( MENU[2] == "human") {
Footer = strftime() TopFooter
} else if (MENU[2] == "POSIX") {
Footer = systime() TopFooter
}
}
The main disadvantage of this approach is that our server is slow and can
handle only one request at a time. Its main advantage is that the server
consists of just one gawk program. No need for installing an
httpd, no need for static separate HTML files, CGI scripts or
root privileges. This is rapid prototyping.
Start this program on the same host that runs your browser. Then let your
browser point to <http://localhost:8080>.
It is also possible to include images into the HTML pages.
Most browsers support the not very well-known
.xbm format,
which may contain only
monochrome pictures but is an ASCII format. Binary images are possible but
not so easy to handle. Another way of including images is to generate them
with a tool like
GNUPLOT
by calling the tool with the system function or through a pipe.
In the preceding section, we built the core logic for event driven GUIs.
In this section, we will finally extend the core to a real application.
No one would actually write a commercial web server in gawk but
it is instructive to see that it is feasible in principle.
The application is ELIZA, the famous program by Joseph Weizenbaum that mimics the behavior of a professional psychotherapist when talking to you. Weizenbaum would certainly object to this description, but this is part of the legend around ELIZA. Take the site independent core logic and append the following code.
You will recognize that SetUpServer is similar to the example
above, except for calling another function, SetUpEliza.
You can use this approach to implement other kinds of servers.
The only changes needed to do so are hidden in the functions
SetUpServer and HandleGET. Perhaps you also want to
implement other HTTP methods.
The igawk program that comes with gawk
may be useful for this process.
When extending this example to a complete application, the first
thing to do is to implement the function SetUpServer that
initializes the HTML pages and some variables. These initializations
determine the way your HTML pages will look (colors, titles, menu
items etc.).
function SetUpServer() {
SetUpEliza()
TopHeader = "<HTML><title>An HTTP-based System with GAWK</title>\
<HEAD><META HTTP-EQUIV=\"Content-Type\"\
CONTENT=\"text/html; charset=iso-8859-1\"></HEAD>\
<BODY BGCOLOR=\"#ffffff\" TEXT=\"#000000\" LINK=\"#0000ff\"\
VLINK=\"#0000ff\" ALINK=\"#0000ff\"> <A NAME=\"top\">"
TopDoc = "\
<h2>Please choose one of the following actions:</h2>\
<UL>\
<LI><A HREF=" MyPrefix "/AboutServer>About this server</A>\
<LI><A HREF=" MyPrefix "/AboutELIZA>About Eliza</A>\
<LI><A HREF=" MyPrefix "/StartELIZA>Start talking to Eliza</A>\
</UL>"
TopFooter = "</BODY></HTML>"
}
The function HandleGET decides which page the user wants to see
next. It is a nested case selection. Each nesting level refers to a menu
level of the GUI. Each case implements a certain action of the menu. On the
deepest level of case selection the handler essentially knows what the
user wants and stores the answer into the variable that holds the HTML
page contents.
function HandleGET() {
# A real HTTP server would treat some parts of the URI as a file name.
# We take parts of the URI as menu choices and go on accordingly.
if(MENU[2] == "AboutServer") {
Document = "This is not a CGI script.\
This is an httpd, an HTML file and a CGI script all in one GAWK script.\
It needs no separate www-server, no installation and no root privileges.\
<br><br>To run it, do this:<br><ul>\
<li> start this script with \"gawk -f httpserver.awk\",<br>\
<li> and on the same host let your www browser open location\
\"http://localhost:8080\"\
</ul>\<br>\ Details of HTTP come from:<br><ul>\
<li>Hethmon: Illustrated Guide to HTTP<br>\
<li>RFC 2068<br></ul><br>JK 14.9.1997<br>"
} else if (MENU[2] == "AboutELIZA") {
Document = "This is an implementation of the famous ELIZA program\
by Joseph Weizenbaum. It is written in GAWK and uses\
an HTML GUI."
} else if (MENU[2] == "StartELIZA") {
gsub(/\+/, " ", GETARG["YouSay"])
# Here we also have to substitute coded special characters
Document = "<form method=GET>" \
"<h3>" ElizaSays(GETARG["YouSay"]) "</h3>\
<br><input type=text name=YouSay value=\"\" size=60>\
<br><input type=submit value=\"Tell her about it\"> </form>"
}
}
Now we are down at the heart of ELIZA. Here you can see how it works. Initially the user does not say anything; then ELIZA resets its money counter and just asks the user to tell open heartedly what comes to mind. The subsequent answers are first converted to upper case and stored for later comparison. ELIZA will present the bill when being confronted with a sentence that contains the phrase "shut up." Otherwise it looks for keywords in the sentence, conjugates the rest of the sentence, remembers the keyword for later use and finally selects an answer from the set of possible answers.
function ElizaSays(YouSay) {
if (YouSay == "") {
cost = 0
answer = "HI, IM ELIZA, TELL ME YOUR PROBLEM"
} else {
q = toupper(YouSay)
gsub("'", "", q)
if(q == qold) {
answer = "PLEASE DONT REPEAT YOURSELF !"
} else {
if (index(q, "SHUT UP") > 0) {
answer = "WELL, PLEASE PAY YOUR BILL. ITS EXACTLY ... $"\
int(100*rand()+30+cost/100)
} else {
qold = q
w = "-" # no keyword recognized yet
for (i in k) { # search for keywords
if (index(q, i) > 0) {
w = i
break
}
}
if (w == "-") { # no keyword, take old subject
w = wold
subj = subjold
} else { # find subject
subj = substr(q, index(q, w) + length(w)+1)
wold = w
subjold = subj # remember keyword and subject
}
for (i in conj)
gsub(i, conj[i], q) # conjugation
# from all answers to this keyword, select one randomly
answer = r[indices[int(split(k[w], indices) * rand()) + 1]]
# insert subject into answer
gsub("_", subj, answer)
}
}
}
cost += length(answer) # for later payment : 1 cent per character
return answer
}
In the long but simple function SetUpEliza you can see tables
for conjugation, keywords and answers. The associative array k[]
contains indices into the array of answers r[]. To choose an
answer, ELIZA just picks an index randomly.
function SetUpEliza() {
srand()
wold = "-"
subjold = " "
# table for conjugation
conj[" ARE " ] = " AM "
conj["WERE " ] = "WAS "
conj[" YOU " ] = " I "
conj["YOUR " ] = "MY "
conj[" IVE " ] =\
conj[" I HAVE " ] = " YOU HAVE "
conj[" YOUVE " ] =\
conj[" YOU HAVE "] = " I HAVE "
conj[" IM " ] =\
conj[" I AM " ] = " YOU ARE "
conj[" YOURE " ] =\
conj[" YOU ARE " ] = " I AM "
# table of all answers
r[1] = "DONT YOU BELIEVE THAT I CAN _"
r[2] = "PERHAPS YOU WOULD LIKE TO BE ABLE TO _ ?"
...
# table for looking up answers that fit to a certain keyword
k["CAN YOU"] = "1 2 3"
k["CAN I"] = "4 5"
k["YOU ARE"] =\
k["YOURE"] = "6 7 8 9"
}
Some interesting remarks and details (including the original source code of ELIZA) can be found on Mark Humphrys' home page. Yahoo also has a page with a collection of ELIZA-like programs. Many of them are written in Java and some even supply source code.
By now you have probably noticed that debugging a networked application is more complicated than debugging a single-process/single-hosted application. The behavior of a networked application sometimes looks non-causal because it is not reproducible in a strong sense. Wether your network application works or not sometimes depends on
The most difficult problems for a beginner arise from hidden states of the
underlying network. After closing a TCP connection, you often have to wait
a short while before reopening the connection. Even more difficult is the
establishment of a connection that formerly ended with a "broken pipe."
Those connections have to "time out" for a minute or so
before you can reopen the
connection. You can check this with the command netstat -a which
gives you a list of still "active" connections.
Now, you have learned enough to build your own application. You could, for example, take part in the Loebner Contest to win $100,000. The Loebner Prize is the first formal instantiation of a Turing Test. Hugh Loebner agreed with The Cambridge Center for Behavioral Studies to underwrite a contest designed to implement the Turing Test. Dr. Loebner pledged a Grand Prize of $100,000 for the first computer whose responses were indistinguishable from a human's. Each year an annual prize of $2000 and a bronze medal is awarded to the most human computer. The winner of the annual contest is the best entry relative to other entries that year, irrespective of how good it is in an absolute sense. Here is an example of a conversation with the winning program of 1997:
(c)1997 Cambridge Center For Behavioral Studies all rights reserved [CONVERSE] [Intelligent Research Ltd.] Start at: [1997/04/29 08:59:40] PROGRAM[10:39:20]Hi, my name is Catherine, what's yours? JUDGE02[10:39:36]My name is Nathan. PROGRAM[10:39:37]Well, it's nice to meet you, Nathan. PROGRAM[10:39:45]Did you see that story on CNN last night about the lesbian PROGRAM[10:40:03]couple who came out at a White House party on Sunday? JUDGE02[10:40:45]No. I'm sorry I missed that. How did the Prez take it? PROGRAM[10:40:47]Ellen Degeneres was one of them - she was kissing her lover PROGRAM[10:41:08]in front of Bill Clinton. Do you think he was very PROGRAM[10:41:21]embarrassed? JUDGE02[10:41:37]You tell me. I didn't see it. PROGRAM[10:41:38]Are you still a Friend of Bill Clinton? JUDGE02[10:42:22]Yes. I would like to talk about something else. Do you know anything about sculpture. PROGRAM[10:42:24]Well, I suppose he's doing his best like most of us, but he PROGRAM[10:42:35]does seem to attract an UNUSUAL amount of bad publicity, PROGRAM[10:42:51]wouldnt you say--can it all be bad luck? JUDGE02[10:43:20]I asked you if you knew anything about sculpture. PROGRAM[10:43:21]OK, but what happens now--does it all drift on, with PROGRAM[10:43:36]everyone waiting to see how much his friends have said about PROGRAM[10:43:47]him under threat of lots and lots of jail-or will something PROGRAM[10:44:01]dramatic actually happen? JUDGE02[10:44:19]Do you know what sculpture is? PROGRAM[10:44:20]Well, youre more a fan of his than I am I guess---though I PROGRAM[10:44:34]cant SWEAR what Id have done in that locked hotel room, I PROGRAM[10:44:51]must say. JUDGE02[10:45:26]Have you ever been to the Salmagundi Club? PROGRAM[10:45:29]Never. to go back to the original discussion Time to get PROGRAM[10:45:43]off this one I think and onto something more down to earth! JUDGE02[10:46:20]What is more down to earth than art? PROGRAM[10:46:21]I don't know what -- to be honest. - PROGRAM[10:46:30]I suppose it depends on where you're coming from, but as the PROGRAM[10:46:46]song goes in My Fair Lady, "Why can't a woman be more like a PROGRAM[10:47:03]man? " JUDGE02[10:47:52]I liked that song but I prefer "Why can't children be more like we are" JUDGE02[10:48:10]from another play the name of which I cannot remember. PROGRAM[10:48:12]What, if anything, do you enjoy about being a man? JUDGE02[10:49:01]I would enjoy all aspects of life no matter what my gender. PROGRAM[10:49:02]Do you think of yourself as being attractive?
This program insists on always speaking about the same story around Bill
Clinton. You see, even a program with a rather narrow mind can behave so
much like a human being that it can win this prize. It is quite common to
let these programs talk to each other via network connections. But during the
competition itself, the program and its computer have to be present at the
place the competition is held. We all would love to see a gawk
program win in such an event. Maybe it is up to you to accomplish this?
Some other ideas for useful networked applications:
doc/awkforai.txt in the gawk distribution.
It was written by Ronald P. Loui (Associate Professor of
Computer Science, at Washington University in St. Louis,
loui@ai.wustl.edu) and summarizes why
he teaches gawk to students of Artificial Intelligence. Here are
some passages from the text:
The GAWK manual can be consumed in a single lab session and the language can be mastered by the next morning by the average student. GAWK's automatic initialization, implicit coercion, I/O support and lack of pointers forgive many of the mistakes that young programmers are likely to make. Those who have seen C but not mastered it are happy to see that GAWK retains some of the same sensibilities while adding what must be regarded as spoonsful of syntactic sugar.
...
There are further simple answers. Probably the best is the fact that increasingly, undergraduate AI programming is involving the Web. Oren Etzioni (University of Washington, Seattle) has for a while been arguing that the "softbot" is replacing the mechanical engineers' robot as the most glamorous AI testbed. If the artifact whose behavior needs to be controlled in an intelligent way is the software agent, then a language that is well-suited to controlling the software environment is the appropriate language. That would imply a scripting language. If the robot is KAREL, then the right language is "turn left; turn right." If the robot is Netscape, then the right language is something that can generatenetscape -remote 'openURL(http://cs.wustl.edu/~loui)'with elan.
...
AI programming requires high-level thinking. There have always been a few gifted programmers who can write high-level programs in assembly language. Most however need the ambient abstraction to have a higher floor.
...
Second, inference is merely the expansion of notation. No matter whether the logic that underlies an AI program is fuzzy, probabilistic, deontic, defeasible, or deductive, the logic merely defines how strings can be transformed into other strings. A language that provides the best support for string processing in the end provides the best support for logic, for the exploration of various logics, and for most forms of symbolic processing that AI might choose to call "reasoning" instead of "logic." The implication is that PROLOG, which saves the AI programmer from having to write a unifier, saves perhaps two dozen lines of GAWK code at the expense of strongly biasing the logic and representational expressiveness of any approach.
Now that gawk itself can connect to the Internet, it should be obvious
that it is suitable for writing intelligent web agents.
awk is strong at pattern recognition and string processing.
So, it is well suited to the classic problem of language translation.
A first try could be a program that knows the 100 most frequent English
words and their counterparts in German or French. The service could be
implemented by regularly reading email with the program above, replacing
each word by its translation and sending the translation back via SMTP.
Users would send an English email to their translation service and get
back a translated email in return. As soon as this works, more effort can be
spent on a real translation program.
gawk service that reads the email. It looks
for keywords in the mail and assembles a reply email accordingly. By carefully
investigating the email header also and repeating these keywords through the
reply email, it is rather simple to give the customer a feeling that
someone cares. Ideally, such a service would search a database of previous
cases for solutions. If none exists, the database could, for example, consist
of all the newsgroups, mailing lists and FAQs on the Internet.
In this chapter, we will look at some self-contained scripts that meet at least one of these criteria:
gawk.
Here, the emphasis is on concise networking. The applications mentioned near the end of Where To Go From Here, do not meet this requirement because they will result in long programs that need careful examination of many special cases and in-depth knowledge of vast areas of well established fields other than networking.
We will often refer to the site-independent core of the server that
we built in
A Simple Web Server.
This means the BEGIN part of the
ELIZA program. When building new and non-trivial servers, we will
always copy this building block and append new instances of the two
functions SetUpServer and HandleGET.
Does it really make sense to employ this same scheme again and again
with varying content? Yes, because this scheme of event-driven
execution provides gawk with an interface to the most widely
accepted standard for GUIs: the web browser. Now, gawk can even rival
Tcl/Tk.
Tcl and gawk have much in common. Both are simple scripting languages
that allow us to quickly solve problems with short programs. But Tcl has Tk
on top of it and gawk had nothing comparable up to now. While Tcl
needs a large and ever changing libray (Tk, which was bound to the X-Window
environment until recently), gawk needs just the networking interface
and some kind of browser on the client's side. Besides better portability,
the most important advantage of this approach (embracing well established
standards like HTTP and HTML) is, that we do not need to change the
language. We let others do the work of fighting over protocols and standards.
We can use HTML, JavaScript, VRML or whatever else comes along to do our work.
Perhaps you thought the "Hello world" example in
A Primitive Web Service,
was useless? By adding just a few lines, we can turn it into something useful.
The PANIC program below tells everyone who connects that the local site is not working. When a web server breaks down, it makes a difference if customers get a strange "network unreachable" message or a short message telling them that the server has a problem. In such an emergency the hard disk and everything on it (including the regular web service) may be unavailable. Rebooting the web server off a diskette makes sense in this setting.
To start the PANIC program as an emergency web server, you need just the
gawk executable and the program below on your diskette. By default,
it will connect to port 8080. You can supply a different value from the
command line.
BEGIN {
RS = ORS = "\r\n"
if (MyPort == 0) MyPort = 8080
HttpService = "/inet/tcp/" MyPort "/0/0"
Hello = "<HTML><H1>" \
"This site is temporarily out of service." \
"</H1></HTML>"
Len = length(Hello) + length(ORS)
while ("Perl" != "elegant") {
print "HTTP/1.0 200 OK" |& HttpService
print "Content-Length: " Len ORS |& HttpService
print Hello |& HttpService
while ((HttpService |& getline) > 0)
continue;
close(HttpService)
}
}
GETURL is a versatile building block for shell scripts that need to retrieve
files from the Internet. It takes a web address as command line parameter and
tries to retrieve the contents of this address. The contents are printed
to standard ouput, while the header is printed to /dev/stderr.
A surrounding shell script
could analyze the contents and extract the text or the links. An ASCII
browser could be written around GETURL. But more interestingly, web robots are
straightforward to write on top of GETURL. On the Internet, you can find
several programs of the same name that do the same job. They are usually
much more complex internally and at least 10 times longer.
At first, GETURL checks if it was called with exactly one web address.
Then, it checks if the user chose to use a special proxy server whose name
is handed over in a variable. By default, it is assumed that the local
machine serves as proxy. GETURL uses the GET method by default
to access the web page. By handing over the name of a different method
(like HEAD) it is possible to choose a different behavior. With
the HEAD method, the user will not receive the body of the page
content but just the header.
BEGIN {
if (ARGC != 2) {
print "GETURL - retrieve web page via HTTP 1.0"
print "IN:\n the URL as a command line parameter"
print "PARAM(S):\n -v Proxy=MyProxy"
print "OUT:\n the page content on stdout"
print " the page header on stderr"
print "JK 16.05.1997"
print "ADR 13.08.2000"
exit
}
URL = ARGV[1]; ARGV[1] = ""
if (Proxy == "") Proxy = "127.0.0.1"
if (ProxyPort == 0) ProxyPort = 80
if (Method == "") Method = "GET"
HttpService = "/inet/tcp/0/" Proxy "/" ProxyPort
ORS = RS = "\r\n\r\n"
print Method " " URL " HTTP/1.0" |& HttpService
HttpService |& getline Header
print Header > "/dev/stderr"
while ((HttpService |& getline) > 0)
printf "%s", $0
close(HttpService)
}
You may change this program as needed, but be careful with the last lines.
Make sure transmission of binary data is not corrupted by additional line
breaks. Even as it is now, the byte sequence "\r\n\r\n" would
disappear if it was contained in binary data. You might get caught in a
trap when trying a quick fix on this one.
Today, you often find powerful processors in embedded systems. Dedicated network routers and controllers for all kinds of machinery are examples of embedded systems. Processors like the Intel x86 or the AMD Elan are able to run multitasking operating systems like XINU or GNU/Linux in embedded PCs.
These systems are small and usually do not have a keyboard or a display. Therefore it is difficult to set up their configuration. There are several widespread ways to set them up:
telnet or SNMP
In this section, we will look at a solution that uses HTTP connections
to control variables of an embedded system that are stored in a file.
Since embedded systems have tight limits on resources like memory,
it is difficult to employ advanced techniques like SNMP and HTTP
servers. So, gawk fits in quite nicely with its single executable
that needs just a short script to start working.
The following program stores the variables in a file and a concurrent
process in the embedded system may read the file. The program uses the site
independent part of the simple web server that we developed in
A Web Service with Interaction.
As mentioned there, all we have to do is to write two new procedures
SetUpServer and HandleGET.
function SetUpServer() {
TopHeader = "<HTML><title>Remote Configuration</title>"
TopDoc = "\
<h2>Please choose one of the following actions:</h2>\
<UL>\
<LI><A HREF=" MyPrefix "/AboutServer>About this server</A>\
<LI><A HREF=" MyPrefix "/ReadConfig>Read Configuration</A>\
<LI><A HREF=" MyPrefix "/CheckConfig>Check Configuration</A>\
<LI><A HREF=" MyPrefix "/ChangeConfig>Change Configuration</A>\
<LI><A HREF=" MyPrefix "/SaveConfig>Save Configuration</A>\
</UL>"
TopFooter = "</HTML>"
if (ConfigFile == "") ConfigFile = "config.asc"
}
The function SetUpServer initializes the top level HTML texts
as usual. It also initializes the name of the file that contains the
configuration parameters and their values. In case the user supplied
a name from the command line, that name is used. The file is expected to
contain one parameter per line, with the name of the parameter in
column one and the value in column two.
The function HandleGET reflects the structure of the menu
tree as usual. The first menu choice tells the user what this is all
about. The second choice reads the configuration file line by line
and stores the parameters and their values. Notice that the record
separator for this file is "\n" in contrast to the record separator
for HTTP. The third menu choice builds up an HTML table to show
the contents of the configuration file just read. The fourth choice
does the real work of changing parameters and the last one just saves
the configuration into a file.
function HandleGET() {
if(MENU[2] == "AboutServer") {
Document = "This is a GUI for remote configuration of an\
embedded system. It is is implemented as one GAWK script."
} else if (MENU[2] == "ReadConfig") {
RS = "\n"
while ((getline < ConfigFile) > 0)
config[$1] = $2;
close(ConfigFile)
RS = "\r\n"
Document = "Configuration has been read."
} else if (MENU[2] == "CheckConfig") {
Document = "<TABLE BORDER CELLPADDING=5>"
for (i in config)
Document = Document "<TR><TD>" i "</TD>" \
"<TD>" config[i] "</TD></TR>"
Document = Document "</TABLE>"
} else if (MENU[2] == "ChangeConfig") {
if ("Param" in GETARG) { # any parameter to set?
if (GETARG["Param"] in config) { # is parameter valid?
config[GETARG["Param"]] = GETARG["Value"]
Document = (GETARG["Param"] " = " GETARG["Value"] ".")
} else {
Document = "Parameter <b>" GETARG["Param"] "</b> is invalid."
}
} else {
Document = "<FORM method=GET><h4>Change one parameter</h4>\
<TABLE BORDER CELLPADDING=5>\
<TR><TD>Parameter</TD><TD>Value</TD></TR>\
<TR><TD><input type=text name=Param value=\"\" size=20></TD>\
<TD><input type=text name=Value value=\"\" size=40></TD>\
</TR></TABLE><input type=submit value=\"Set\"></FORM>"
}
} else if (MENU[2] == "SaveConfig") {
for (i in config)
printf("%s %s\n", i, config[i]) > ConfigFile
close(ConfigFile)
Document = "Configuration has been saved."
}
}
We could also view the configuration file as a database. From this point of view, the above program acts like a primitive database server. Real SQL database systems also make a service available by providing a TCP port that clients can connect to. But the application level protocols they use are usually proprietary and also change from time to time. This is also true for the protocol that MiniSQL uses.
Most people who make heavy use of Internet resources have a large
bookmark file with pointers to interesting web sites. It is impossible
to regularly check by hand if any of these sites have changed. A program
is needed to automatically look at the headers of web pages and tell,
which ones have changed. URLCHK does the comparison after using GETURL
with the HEAD method to retrieve the header.
Like GETURL, this program first checks that it was called with exactly
one command line parameter. URLCHK also takes the same variables
Proxy and ProxyPort from the command line as GETURL
because these variables are handed over to GETURL for each URL
that gets checked. The one and only parameter is the name of a file that
contains one line for each URL. In the first column we find the URL and
the second and third columns hold the length of the URL's body when checked
for the two last times. Now, we follow this plan:
It may seem a bit peculiar to read the URLs from a file together with their two most recent lengths but this approch has several advantages. You can call the program again and again with the same file. After running the program, you can regenerate the changed URLs by extracting those lines that differ in their second and third columns.
BEGIN {
if (ARGC != 2) {
print "URLCHK - check if URLs have changed"
print "IN:\n the file with URLs as a command line parameter"
print " file contains URL, old length, new length"
print "PARAMS:\n -v Proxy=MyProxy -v ProxyPort=8080"
print "OUT:\n same as file with URLs"
print "JK 02.03.1998"
exit
}
URLfile = ARGV[1]; ARGV[1] = ""
if (Proxy != "") Proxy = " -v Proxy=" Proxy
if (ProxyPort != "") ProxyPort = " -v ProxyPort=" ProxyPort
while ((getline < URLfile) > 0)
Length[$1] = $3 + 0
close(URLfile) # now, URLfile is read in and can be updated
GetHeader = "gawk " Proxy ProxyPort " -v Method=\"HEAD\" -f geturl.awk "
for (i in Length) {
GetThisHeader = GetHeader i " 2>&1"
while ((GetThisHeader | getline) > 0)
if (toupper($0) ~ /CONTENT-LENGTH/) NewLength = $2 + 0
close(GetThisHeader)
print i, Length[i], NewLength > URLfile
if (Length[i] != NewLength) # report only changed URLs
print i, Length[i], NewLength
}
close(URLfile)
}
Another thing that may look strange is the way GETURL is called.
Before calling GETURL, we have to check if the proxy variables need
to be passed on. If so, we prepare strings that will become part
of the command line later. In GetHeader we store these strings
together with the longest part of the command line. Later, in the loop
over the URLs, GetHeader is appended with the URL and a redirection
operator to form the command that reads the URL's header over the net.
GETURL always produces the headers over /dev/stderr. That is
the reason why we need the redirection operator to get the header
piped in.
This program is not perfect because it assumes that changing URLs result in changed lengths, which is not necessarily true. A more advanced approch would be to look at some other header line that holds time information. But as always when things get a bit more complicated, this is left as an exercise to the reader.
Sometimes it is necessary to extract links from web pages. Browsers do it, web robots do it and sometimes even a human being wants to extract all links in a web page. Having a tool like GETURL at hand, we can solve this problem with some help from the Bourne shell.
BEGIN { RS = "http://[#%&\+\-\./0-9\:;\?A-Z_a-z\~]*" }
RT != "" {
command = ("gawk -v Proxy=MyProxy -f geturl.awk", RT, "> doc" NR ".html")
print command
}
This program reads an HTML file and prints all the HTTP links that it finds.
It relies on gawk's ability to use regular expressions as record
separators. With RS set to a regular expression that matches links,
the second action is executed each time a non-empty link has been found.
We can find the matching link itself in RT.
Notice that the regular expression for URLs is rather crude. A precise
regular expression would be much more complex. But the one above works
rather well. One problem is that it is unable to find internal links of
an HTML document. In addition, it is straightforward to also include
ftp, telnet, news, mailto and other kinds
of links in the regular expression if this was necessary for other tasks.
The action could use the system function to let just another GETURL
retrieve the page, but here we use a different approach. Instead, we let
this simple program print shell commands that can be piped into a sh
for execution. This way it is possible to first extract
the links, wrap shell commands around them and pipe all the shell commands
into a file. After editing the file, execution of the file will retrieve
exactly those files that we really need. In case we do not want to edit,
we can retrieve all the pages like this:
gawk -f geturl.awk http://www.suse.de | gawk -f webgrab.awk | sh
After this, you will find the contents of all referenced documents in
files named doc*.html even if they do not contain HTML code.
The most annoying thing is that we always have to pass the proxy to
GETURL. If you do not like to see the headers of the web pages
appear on the screen, you can redirect them to /dev/null.
Watching the headers appear can be quite interesting because you
can see interesting details like which web server the companies use.
Now, you can imagine how the robots work that tell the clever marketing
people the market shares
of Microsoft and Netscape in the web server market.
Port 80 of any web server is like a small hole in a repellent firewall. After attaching a browser to port 80, we will usually catch a glimpse of the bright side of the server (its home page). With a tool like GETURL at hand, we are able to discover some of the more concealed or even "indecent" (i.e. lacking conformity to standards of quality) services. It can be exciting to see the fancy CGI scripts that lie there, revealing the inner workings of the server, and ready to be called.
gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/
some servers will give you a directory listing of the CGI files.
Knowing the names, you can try to call some of them and watch
for useful results. Sometimes there are executables in such directories,
(like perl interpreters) that you may call remotely. If there are
subdirectories with configuration data of the web server, this can also
be quite interesting to read.
/cgi-bin. There you can often find the scripts
test-cgi and printenv. Both will tell you some things
about the current connection and the installation of the web server.
Just call
gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/test-cgi gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/printenv
/etc/passwd.
(We don't recommend this!)
Although this may sound funny or simply irrelevant, we are talking about severe security holes. Try to explore your own system this way and make sure that none of the above reveals too much information about your system.
In all the HTTP server examples above, we never presented an image
to the browser and its user. Presenting images is one task. Generating
images that reflect some user input and presenting these dynamically
generated images is another. In this section we will use
GNUPLOT
for generating .png, .ps or .gif files.
6
The program we will develop takes the statistical parameters of two samples
and computes the t-test statistics. As a result, we get the probabilities
that the means and the variances of both samples are the same. In order to
let the user check plausibility, the program presents an image of the
distributions. The statistical computation follows
Numerical Recipes
by Press et al. Since gawk does not have a builtin function
for the computation of the beta function, we use the ibeta function
of GNUPLOT. As a side effect, we will learn how to use GNUPLOT as a
sophisticated calculator. The comparison of means is done as in tutest,
paragraph 14.2 page 613 and the comparison of variances as in ftest,
page 611 in Numerical Recipes.
As usual, we take the site independent code for servers and append
our own functions SetUpServer and HandleGET.
function SetUpServer() {
TopHeader = "<HTML><title>Statistics with GAWK</title>"
TopDoc = "\
<h2>Please choose one of the following actions:</h2>\
<UL>\
<LI><A HREF=" MyPrefix "/AboutServer>About this server</A>\
<LI><A HREF=" MyPrefix "/EnterParameters>Enter Parameters</A>\
</UL>"
TopFooter = "</HTML>"
GnuPlot = "gnuplot 2>&1"
m1=m2=0; v1=v2=1; n1=n2=10
}
Here, you see the menu structure that the user will see. Later, we
will see how the program structure of the HandleGET function
reflects the menu structure. What is missing here is the link for the
image we will generate. In an event driven environment, request,
generation and delivery of images are separated.
Notice the way we initialize the GnuPlot command string for
the pipe. By default,
GNUPLOT will output the generated image via standard output and
the results of printed calculations via standard error.
The redirection will cause standard error to be mixed into standard
ouput, enabling us to read results of calculations with getline.
By initializing the statistical parameters with some meaningful
defaults, we make sure the user will get an image the first time
he uses the program.
Below you find the rather long function HandleGET which
implements the contents of this service by reacting to the different
kinds of requests from the browser. Before you start playing with
this script, make sure your browser supports JavaScript and it also
has this option switched on. The script below uses a short snippet of
JavaScript code for delayed opening of a window with an image.
A more detailed explanation follows below.
function HandleGET() {
if(MENU[2] == "AboutServer") {
Document = "This is a GUI for a statistical computation.\
It compares means and variances of two distributions.\
It is implemented as one GAWK script and uses GNUPLOT."
} else if (MENU[2] == "EnterParameters") {
Document = ""
if ("m1" in GETARG) { # are there parameters to compare?
Document = Document "<SCRIPT LANGUAGE=\"JavaScript\">\
setTimeout(\"window.open(\\\"" MyPrefix "/Image" systime()\
"\\\",\\\"dist\\\", \\\"status=no\\\");\", 1000); </SCRIPT>"
m1 = GETARG["m1"]; v1 = GETARG["v1"]; n1 = GETARG["n1"]
m2 = GETARG["m2"]; v2 = GETARG["v2"]; n2 = GETARG["n2"]
t = (m1-m2)/sqrt(v1/n1+v2/n2)
df = (v1/n1+v2/n2)*(v1/n1+v2/n2)/((v1/n1)*(v1/n1)/(n1-1) + (v2/n2)*(v2/n2)
/(n2-1))
if (v1>v2) { f = v1/v2; df1=n1-1; df2=n2-1
} else { f = v2/v1; df1=n2-1; df2=n1-1
}
print "pt=ibeta(" df/2 ",0.5," df/(df+t*t) ")" |& GnuPlot
print "pF=2.0*ibeta(" df2/2 "," df1/2 "," df2/(df2+df1*f) ")" |& GnuPlot
print "print pt, pF" |& GnuPlot
RS="\n"; GnuPlot |& getline; RS="\r\n" # $1 is pt, $2 is pF
print "invsqrt2pi=1.0/sqrt(2.0*pi)" |& GnuPlot
print "nd(x)=invsqrt2pi/sd*exp(-0.5*((x-mu)/sd)**2)" |& GnuPlot
print "set term png small color" |& GnuPlot
#print "set term postscript color" |& GnuPlot
#print "set term gif medium size 320,240" |& GnuPlot
print "set yrange[-0.3:]" |& GnuPlot
print "set label 'p(m1=m2) =" $1 "' at 0,-0.1 left" |& GnuPlot
print "set label 'p(v1=v2) =" $2 "' at 0,-0.2 left" |& GnuPlot
print "plot mu=" m1 ",sd=" sqrt(v1) ", nd(x) title 'sample 1',\
mu=" m2 ",sd=" sqrt(v2) ", nd(x) title 'sample 2'" |& GnuPlot
print "quit" |& GnuPlot
GnuPlot |& getline Image
while ((GnuPlot |& getline) > 0) Image = Image RS $0
close(GnuPlot)
}
Document = Document "\
<h3>Do these samples have the same Gaussian distribution?</h3>\
<FORM METHOD=GET> <TABLE BORDER CELLPADDING=5>\
<TR>\
<TD>1. Mean </TD><TD><input type=text name=m1 value=" m1 " size=8></TD>\
<TD>1. Variance</TD><TD><input type=text name=v1 value=" v1 " size=8></TD>\
<TD>1. Count </TD><TD><input type=text name=n1 value=" n1 " size=8></TD>\
</TR><TR>\
<TD>2. Mean </TD><TD><input type=text name=m2 value=" m2 " size=8></TD>\
<TD>2. Variance</TD><TD><input type=text name=v2 value=" v2 " size=8></TD>\
<TD>2. Count </TD><TD><input type=text name=n2 value=" n2 " size=8></TD>\
</TR> <input type=submit value=\"Compute\">\
</TABLE></FORM><BR>"
} else if (MENU[2] ~ "Image") {
Reason = "OK" ORS "Content-type: image/png"
#Reason = "OK" ORS "Content-type: application/x-postscript"
#Reason = "OK" ORS "Content-type: image/gif"
Header = Footer = ""
Document = Image
}
}
As usual, we give a short description of the service in the first
menu choice. The third menu choice shows us that generation and
presentation of an image are two separate actions. While the latter
takes place quite instantly in the third menu choice, the former
takes place in the much longer second choice. Image data passes from the
generating action to the presenting action via the variable Image
that contains a complete .png image which would otherwise be stored
in a file. If you prefer .ps or .gif images over the
default .png images, you may select these options by uncommenting
the appropriate lines. But remember to do so in two places: once when
telling GNUPLOT which kind of images to generate and once when transmitting the
image at the end of the program. Looking at the end of the program,
the way we pass the Content-type to the browser is a bit unusual.
It is appended to the OK of the first header line
to make sure the type information will become part of the header.
The other variables that get transmitted acrosss the network are
made empty because in this case we do not have an HTML document to
transmit but rather raw image data to be contained in the body.
Most of the work is done in the second menu choice. It starts with a
strange JavaScript code snippet. When first implementing this server,
we used a short <IMG SRC=" MyPrefix "/Image>" here. But then
browsers got smarter and tried to improve on speed by requesting the
image and the HTML code at the same time. When doing this, the browser
tries to build up a connection for the image request while the request for
the HTML text is not yet completed. So, the browser tries to connect
to the gawk server on port 8080 while port 8080 is still in use for
transmission of the HTML text. The connection for the image cannot be
built up, so the image appears as "broken" in the browser window.
We solved this problem by telling the browser to open a separate window
for the image, but only after a delay of 1000 milliseconds.
By this time, this server should be ready for serving the next request.
But there is one more subtlety in the JavaScript code.
Each time the JavaScript code opens a window for the image, the
name of the image is appended with a time stamp (systime).
Why this constant change of name for the image? Initially we always named
the image Image, but then the Netscape browser noticed the name
had not changed since the previous request and displayed the
previous image (caching behavior). You may remember that our server core
is implemented so that browsers are told not to cache anything.
Obviously HTTP requests do not always work as expected. One way to
circumvent the cache of such overly smart browsers is to change the
name of the image with each request. You see, these three lines of JavaScript
caused us much trouble.
The rest can be broken down into two phases. At first, we check if there are statistical parameters. When you first start the program, there usually are no parameters because you are entering the page coming from the top menu. Then, we only have to present the user a form that he can use to change statistical parameters and submit them. Subsequently, the submission of the form will cause the execution of the first phase because now there are parameters to handle.
Now that we have parameters, we know there will be an image available.
Therefore we insert the JavaScript code here to initiate the opening
of the image in a separate window. Then,
we prepare some variables that will be passed to GNUPLOT for calculation
of the probabilities. Prior to reading the results, we must temporarily
change RS because GNUPLOT separates lines with newlines.
After instructing GNUPLOT to generate a .png (or .ps or
.gif) image, we initiate the insertion of some text,
explaining the resulting probabilities. The final plot command
actually generates image data. This raw binary has to be read in carefully
without adding, changing or deleting a single byte. Hence the unusual
initialization of Image and completion with a while loop.
When using this server, you will soon realize that it is far from being perfect. It mixes source code of six scripting languages or protocols:
awk implements a server for the protocol ...
It is probably better not to mix up so many different languages. The result is almost as readable as many Perl scripts. Furthermore, the statistical part of the server does not take care of invalid input. Among others, using negative variances will cause invalid results.
In the long run, every program becomes rococo, and then rubble. Alan Perlis
By now, we know how to present arbitrary Content-types to a browser.
In this section, our server will present a 3D world to our browser.
The 3D world is described in a scene description language (VRML,
Virtual Reality Modeling Language) that allows us to travel through a
perspective view of a 2D maze with our browser. If your browser has a
VRML plugin, you will be able to explore this new technology. We could do
one of those boring Hello world examples here, that are usually
presented when introducing novices to
VRML. If you have never written
any VRML code, have a look at
the VRML FAQ.
Presenting a static VRML scene is a bit trivial; in order to expose
gawk's new capabilities, we will present a dynamically generated
VRML scene. The function SetUpServer is very simple because it
only sets the default HTML page and initializes the random number
generator. As usual, the surrounding server lets you browse the maze.
function SetUpServer() {
TopHeader = "<HTML><title>Walk through a maze</title>"
TopDoc = "\
<h2>Please choose one of the following actions:</h2>\
<UL>\
<LI><A HREF=" MyPrefix "/AboutServer>About this server</A>\
<LI><A HREF=" MyPrefix "/VRMLtest>Watch a simple VRML scene</A>\
</UL>"
TopFooter = "</HTML>"
srand()
}
The function HandleGET is a bit longer because it first computes
the maze and afterwards generates the VRML code that will be sent across
the network. As shown in the STATIST example
(see STATIST),
we set the type of the
content to VRML and then store the VRML representation of the maze as the
page content. We assume that the maze is stored in a 2D array. Initially,
the maze consists of walls only. Then, we add an entry and an exit to the
maze and let the rest of the work be done by the function MakeMaze.
Now, only the wall fields are left in the maze. By iterating over the these
fields, we generate one line of VRML code for each wall field.
function HandleGET() {
if (MENU[2] == "AboutServer") {
Document = "If your browser has a VRML 2 plugin,\
this server shows you a simple VRML scene."
} else if (MENU[2] == "VRMLtest") {
XSIZE = YSIZE = 11 # initially, everything is wall
for (y = 0; y < YSIZE; y++)
for (x = 0; x < XSIZE; x++)
Maze[x, y] = "#"
delete Maze[0, 1] # entry is not wall
delete Maze[XSIZE-1, YSIZE-2] # exit is not wall
MakeMaze(1, 1)
Document = "\
#VRML V2.0 utf8\n\
Group {\n\
children [\n\
PointLight {\n\
ambientIntensity 0.2\n\
color 0.7 0.7 0.7\n\
location 0.0 8.0 10.0\n\
}\n\
DEF B1 Background {\n\
skyColor [0 0 0, 1.0 1.0 1.0 ]\n\
skyAngle 1.6\n\
groundColor [1 1 1, 0.8 0.8 0.8, 0.2 0.2 0.2 ]\n\
groundAngle [ 1.2 1.57 ]\n\
}\n\
DEF Wall Shape {\n\
geometry Box {size 1 1 1}\n\
appearance Appearance { material Material { diffuseColor 0 0 1 } }\n\
}\n\
DEF Entry Viewpoint {\n\
position 0.5 1.0 5.0\n\
orientation 0.0 0.0 -1.0 0.52\n\
}\n"
for (i in Maze) {
split(i, t, SUBSEP)
Document = Document " Transform { translation "
Document = Document t[1] " 0 -" t[2] " children USE Wall }\n"
}
Document = Document " ] # end of group for world\n}"
Reason = "OK" ORS "Content-type: model/vrml"
Header = Footer = ""
}
}
Finally, we have a look at MakeMaze, the function that generates
the Maze array. When entered, this function assumes that the array
has been initialized so that each element represents a wall element and
the maze is initially full of wall elements. Only the entrance and the exit
of the maze should have been left free. The parameters of the function tell
us which element must be marked as not being a wall. After this, we take
a look at the four neighbouring elements and remember which we have already
treated. Of all the neighbouring elements, we take one at random and
walk in that direction. Therefore, the wall element in that direction has
to be removed and then, we call the function recursively for that element.
The maze will only be completed, if we reiterate the above procedure for
all neighbouring elements (in random order) and for our present
element by recursively calling the function for the present element. This
last iteration could have been done in a loop,
but it is done much simpler recursively.
Notice that elements with coordinates that are both odd are assumed to be
on our way through the maze and the generating process cannot terminate
as long as there is such an element not being deleted. All other
elements are potentially part of the wall.
function MakeMaze(x, y) {
delete Maze[x, y] # here we are, we have no wall here
p = 0 # count unvisited fields in all directions
if (x-2 SUBSEP y in Maze) d[p++] = "-x"
if (x SUBSEP y-2 in Maze) d[p++] = "-y"
if (x+2 SUBSEP y in Maze) d[p++] = "+x"
if (x SUBSEP y+2 in Maze) d[p++] = "+y"
if (p>0) { # if there are univisited fields, go there
p = int(p*rand()) # choose one unvisited field at random
if (d[p] == "-x") { delete Maze[x - 1, y]; MakeMaze(x - 2, y)
} else if (d[p] == "-y") { delete Maze[x, y - 1]; MakeMaze(x, y - 2)
} else if (d[p] == "+x") { delete Maze[x + 1, y]; MakeMaze(x + 2, y)
} else if (d[p] == "+y") { delete Maze[x, y + 1]; MakeMaze(x, y + 2)
} # we are back from recursion
MakeMaze(x, y); # try again while there are unvisited fields
}
}
There are two ways of constructing a software design: One way is to make is so simple that there are obviously no deficiencies, and the other way is to make it so complicated that there are no obvious deficiencies. C. A. R. Hoare
A mobile agent is a program that may be dispatched from a computer and transported to a remote server for execution. This is called migration and means that a process on another system is started that is independent from its originator. Ideally, it wanders through a network while working for its creator or owner. In places like the UMBC Agent Web people are quite confident that (mobile) agents are a software engineering paradigm that will enable us to significantly increase the efficiency of our work. Mobile agents could become the mediators between users and the networking world. If you appreciate an unbiased view at this technology, you should have a look at the remarkable paper Mobile Agents: Are they a good idea?.
Anyway, it sounds interesting, let us have a try.
A good instance of this paradigm is
Agent Tcl,
an extension of the Tcl language. After introducing you to a typical
development environment, the aforementioned paper shows a nice little
example application that we will try to rebuild in gawk. The
who agent takes a list of servers and wanders from one server
to the next one, always looking to see who is logged in.
Having reached the last
one, it sends us a message with a list of all users it found on each
machine.
But before implementing something that might or might not be a mobile agent, let us clarify the concept and some important terms. The agent paradigm in general is such a young scientific discipline that it has not yet developed a widely accepted terminology. Some authors try to give precise definitions, but their scope is often not wide enough to be generally accepted. Franklin and Graesser ask Is it an Agent or just a Program: A Taxonomy for Autonomous Agents and give even better answers than Caglayan and Harrison in their Agent FAQ.
Before delving into the (rather demanding) details of implementation, let us give just one more quotation as a final motivation. Steven Farley published an excellent paper called Mobile Agent System Architecture, in which he asks "Why use an agent architecture?"
If client-server systems are the currently established norm and distributed object systems such as CORBA are defining the future standards, why bother with agents? Agent architectures have certain advantages over these other types. Three of the most important advantages are:
- An agent performs much processing at the server where local bandwidth is high, thus reducing the amount of network bandwidth consumed and increasing overall performance. In contrast, a CORBA client object with the equivalent functionality of a given agent must make repeated remote method calls to the server object because CORBA objects cannot move across the network at runtime.
- An agent operates independently of the application from which the agent was invoked. The agent operates asynchronously, meaning that the client application does not need to wait for the results. This is especially important for mobile users who are not always connected to the network.
- The use of agents allows for the injection of new functionality into a system at run time. An agent system essentially contains its own automatic software distribution mechanism. Since CORBA has no built-in support for mobile code, new functionality generally has to be installed manually.
Of course a non-agent system can exhibit these same features with some work. But the mobile code paradigm supports the transfer of executable code to a remote location for asynchronous execution from the start. An agent architecture should be considered for systems where the above features are primary requirements.
When trying to migrate a process from one system to the next we need, of course, a server process on the receiving side. Depending on the kind of server process, several ways of implementation come to mind:
POST method to transfer
some data to a file on the web server. When calling a CGI script
remotely with the POST method instead of the usual GET method,
data is transmitted from the client process to the standard input
of the server's CGI script. So, to implement a mobile agent,
we must not only write the agent program itself (to start on the client
side) but also the CGI script (to receive on the server side).
PUT method for migration. HTTP does not
require a CGI script for migration via PUT. But with common web
servers there is no advantage to this solution, because web servers like
Apache nevertheless require explicite
activation of a special PUT script.
We will abuse a common web server as a migration tool. So, we need a
universal CGI script on the receiving side (the web server). It will be
activated with a POST request. Put it into a location like
/httpd/cgi-bin/PostAgent.sh. Make sure, the server system uses a
version of gawk that supports network access.
#!/bin/sh
MobAg=/tmp/MobileAgent.$$
cat > $MobAg # direct script to mobile agent file
gawk -f $MobAg $MobAg > /dev/null & # execute agent concurrently
# HTTP header, terminator and body
gawk 'BEGIN { print "\r\nAgent started" }'
rm $MobAg # delete script file of agent
By making its process id ($$) part of the unique file name, the
script avoids conflicts between concurrent instances of the script.
First, all lines
from standard input (the mobile agent's source code) are copied into
this unique file. Then, the agent is started as a concurrent process
and a short message reporting this fact is sent to the submitting client.
Finally, the script file of the mobile agent is removed because it is
no longer needed. Although a short script, there are several noteworthy
points about it:
gawk is not the ideal language for such
a job. Lisp and Tcl are more suitable because they do not make a distinction
between program code and data.
Agent started it waves
"Goodbye" to its origin. The originator may choose to terminate or not.
The originating agent itself is started just like any other command line
script and reports the results on standard output.
But how can an agent that migrated to a host far away from its origin report
the result back home when there is no connection any more? By letting the
name of the original host migrate with the agent. Having arrived at the end
of the journey, the agent establishes a connection and reports the results.
This is the reason for determining the name of the host with uname -n
and storing it in MyOrigin for later use.
We may also set variables with the -v option from the
command line. This interactivity is only of importance in the context of starting a mobile
agent, therefore this BEGIN pattern and its action will not take
part in migration.
BEGIN {
if (ARGC != 2) {
print "MOBAG - a simple mobile agent"
print "CALL:\n gawk -f mobag.awk mobag.awk"
print "IN:\n the name of this script as a command line parameter"
print "PARAM:\n -v MyOrigin=myhost.com"
print "OUT:\n the result on stdout"
print "JK 29.03.1998 01.04.1998"
exit
}
if (MyOrigin == "") {
"uname -n" | getline MyOrigin
close("uname -n")
}
}
Since gawk cannot manipulate and transmit parts of the program
directly, we have to read the source code and store it in strings.
Therefore, we scan it for the beginning and the ending of functions.
Each line in between will be appended to the code string until the end of
the function has been reached. A special case is this part of the program
itself. It is not a function. We put a similar frame around it to treat
it like a function. Notice that this mechanism will work for all the
functions of the source code, but it cannot guarantee that the order
of the functions will be preserved during migration.
#ReadMySelf
/^function / { FUNC = $2 }
/^END/ || /^#ReadMySelf/ { FUNC = $1 }
FUNC != "" { MOBFUN[FUNC] = MOBFUN[FUNC] RS $0 }
(FUNC!="") && (/^}/ || /^#EndOfMySelf/) { FUNC = "" }
#EndOfMySelf
When we built the web server code in A Web Service with Interaction, we first developed a site independent core. Likewise, we now build an agent independent core that can be appended with application dependent functions. Meanwhile, we have already reached the only application independent function we need for the mobile agent.
The function migrate prepares the
aforementioned strings containing the program code and transmits them to a
server. A consequence of this modular approach is that the migrate
function takes some parameters that we will not need in this application
but in future ones. Its mandatory parameter Destination holds the
name (or IP address) of the server that the agent wants as a host for its
code. The optional parameter MobCode may contain some gawk
code that will be inserted during migration in front of all other code.
The optional parameter Label may contain
a string that tells the agent what to do in program execution after
arrival at its new home site. One of the serious obstacles in implementing
a framework for mobile agents is that it does not suffice to migrate the
code. We also have to migrate the state of execution of the agent. In
contrast to Agent Tcl, we do not try to migrate the complete set
of variables. We introduce the following convention.
MOBFUN that we saw above is an exception. It is handled
by the function migrate and will migrate with the application.
MOBVAR. Each variable that will
take part in migration has to be an element of this array.
migrate will also take care of this.
Now, you can understand what happens to the Label parameter of the
function migrate. It is copied into MOBVAR["Label"] and
travels alongside the other data. Since travelling takes place via HTTP,
we have to separate records with "\r\n" in RS and
ORS as usual. The code assembly for migration takes place in
three steps:
MOBFUN to collect all functions verbatim.
BEGIN pattern and put assignments to mobile
variables into the action part.
Content-length is followed by the body. In case there is
any reply over the network, we read it completely and echo it to
standard ouput to avoid irritating the server.
function migrate (Destination, MobCode, Label) {
MOBVAR["Label"] = Label
MOBVAR["Destination"] = Destination
RS = ORS = "\r\n"
HttpService = "/inet/tcp/0/" Destination
for (i in MOBFUN)
MobCode = (MobCode "\n" MOBFUN[i])
MobCode = MobCode "\n\nBEGIN {"
for (i in MOBVAR)
MobCode = (MobCode "\n MOBVAR[\"" i "\"] = \"" MOBVAR[i] "\"")
MobCode = MobCode "\n}\n"
print "POST /cgi-bin/PostAgent.sh HTTP/1.0" |& HttpService
print "Content-length:", length(MobCode) ORS |& HttpService
printf MobCode |& HttpService
while ((HttpService |& getline) > 0)
print $0
close(HttpService)
}
The application independent framework is now almost complete. What follows
is the END pattern that is executed when the mobile agent has
finished reading its own code. First, it checks whether it is already
running on a remote host or not. In case initialization has not yet taken
place, it starts MyInit. Otherwise (later, on a remote host) it
starts MyJob.
END {
if (ARGC != 2) exit # stop when called with wrong parameters
if (MyOrigin != "") # is this the originating host?
MyInit() # then we initialize the application
else # we are on a host with migrated data
MyJob() # so we do our job
}
All we have to do to extend the framework into a complete application
is to write two application specific functions MyInit and
MyJob. Keep in mind that the former is executed once on the
originating host, while the latter is executed after each migration.
function MyInit() {
MOBVAR["MyOrigin"] = MyOrigin
MOBVAR["Machines"] = "localhost/80 max/80 moritz/80 castor/80"
split(MOBVAR["Machines"], Machines) # which host is the first?
migrate(Machines[1], "", "") # go to the first host
while (("/inet/tcp/8080/0/0" |& getline)>0) # wait for result
print $0 # print result
close("/inet/tcp/8080/0/0")
}
As mentioned earlier, this agent takes the name of its origin
(MyOrigin) with it. Then, it takes the name of its first
destination and goes there for further work. Notice, that this name has
the port number of the web server appended to the name of the server
because the function migrate needs it this way. Finally, it
waits for the result to arrive.
function MyJob() {
sub(MOBVAR["Destination"], "", MOBVAR["Machines"]) # forget this host
MOBVAR["Result"]=MOBVAR["Result"] SUBSEP SUBSEP MOBVAR["Destination"] ":"
while (("who" | getline) > 0) # who is logged in?
MOBVAR["Result"] = MOBVAR["Result"] SUBSEP $0
close("who")
if (index(MOBVAR["Machines"], "/") > 0) { # any more machines to visit?
split(MOBVAR["Machines"], Machines) # which host is next?
migrate(Machines[1], "", "") # go there
} else { # no more machines
gsub(SUBSEP, "\n", MOBVAR["Result"]) # send result to origin
print MOBVAR["Result"] |& "/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080"
close("/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080")
}
}
After migrating, the first thing to do in MyJob is to delete
the name of the current host from the list of hosts to visit. Now, it
is time to start the real work by appending the host's name to the
result string and reading line by line who is logged in on this host.
A very annoying circumstance is the fact that the elements of
MOBVAR cannot hold the newline character ("\n"). If they
did, migration of this string would not work because the string would
not obey the syntax rule for a string in gawk. As a replacement,
we use SUBSEP temporarily. If the list of hosts to visit holds
at least one more entry, the agent migrates to that place to go on
working there. Otherwise, we replace the SUBSEPs
with a newline character in the resulting string and report it to
the originating host, whose name is stored in MOBVAR["MyOrigin"].
Far out in the uncharted backwarters of the unfashionable end of the Western Spiral arm of the Galaxy lies a small unregarded yellow sun.Orbiting this at a distance of roughly ninety-two million miles is an utterly insignificant little blue green planet whose ape-descendent life forms are so amazingly primitive that they still think digital watches are a pretty neat idea.
This planet has -- or rather had -- a problem, which was this: most of the people living on it were unhappy for pretty much of the time. Many solutions were suggested for this problem, but most of these were largely concerned with the movements of small green pieces of paper, which is odd because it wasn't the small green pieces of paper that were unhappy.
Douglas Adams, The Hitch Hiker's Guide to the Galaxy
Valuable services on the Internet are usually not implemented
as mobile agents. There are much simpler ways of implementing services.
On your Unix system there is, for example, the cron service.
As a user of a Unix system you can write a list of tasks to be done
each day, each week, twice a day or just once. You enter the list into a
file named crontab. If you want to distribute a newsletter
on a daily basis this way, use cron for calling a script each day
early in the morning.
# run at 8 am on weekdays, distribute the newsletter 0 8 * * 1-5 $HOME/bin/daily.job >> $HOME/log/newsletter 2>&1
The script will first look for interesting information on the Internet, assemble it in a nice form and finally send all the stuff via email to the customers. Here is an example of a primitive newsletter on stock market prediction. It is a report which first tries to predict the change of each share in the Dow Jones Industrial Index for the particular day. Then it mentions some especially promising shares as well as some shares which look remarkably bad on that day. The report ends with the usual disclaimer which tells every child not to try this at home and hurt anybody.
Good morning Uncle Scrooge,
This is your daily stock market report for Monday, October 16, 2000.
Here are the predictions for today:
AA neutral
GE up
JNJ down
MSFT neutral
...
UTX up
DD down
IBM up
MO down
WMT up
DIS up
INTC up
MRK down
XOM down
EK down
IP down
The most promising shares for today are these:
INTC http://biz.yahoo.com/n/i/intc.html
The stock shares to avoid today are these:
EK http://biz.yahoo.com/n/e/ek.html
IP http://biz.yahoo.com/n/i/ip.html
DD http://biz.yahoo.com/n/d/dd.html
...
If you are not into stock market prediction but want to earn money with a more humane service, you might prefer to send out horoscopes to your customers. Or, once every refrigerator in every household on this side of the Chinese Wall is connected to the Internet, such a service could inspect the contents of your customer's refrigerators each day and advise them on nutrition. Big Brother is watching them.
The script as a whole is rather long. In order to ease the pain of studying other people's source code, we have broken the script up into meaningful parts which are invoked one after the other.
BEGIN {
Init()
ReadQuotes()
CleanUp()
Prediction()
Report()
SendMail()
}
The earlier parts store data into variables and arrays which are
subsequently used by later parts of the script. The function Init
first checks if the script is invoked correctly (without any parameters).
If not, it prompts the user for correct usage. What follows are preparations
for the retrieval of the historical quote data. The names of the 30 stock
shares are stored in an array name along with the current date
in day, month, and year. All users who are separated
from the Internet by a firewall and have to direct their Internet accesses
to a proxy, must supply the name of the proxy to this script with the
option -v Proxy=name. For most users, the default proxy and
port number should suffice.
function Init() {
if (ARGC != 1) {
print "STOXPRED - daily stock share prediction"
print "IN:\n no parameters, nothing on stdin"
print "PARAM:\n -v Proxy=MyProxy -v ProxyPort=80"
print "OUT:\n commented predictions as email"
print "JK 09.10.2000"
exit
}
# Remember all ticker symbols of the Dow Jones Industrial Index
StockCount = split("AA GE JNJ MSFT AXP GM JPM PG BA HD KO \
SBC C HON MCD T CAT HWP MMM UTX DD IBM MO WMT DIS INTC \
MRK XOM EK IP", name);
# Remember the current date as the end of the time series
day = strftime("%d")
month = strftime("%m")
year = strftime("%Y")
if (Proxy == "") Proxy = "chart.yahoo.com"
if (ProxyPort == 0) ProxyPort = 80
YahooData = "/inet/tcp/0/" Proxy "/" ProxyPort
}
There are two really interesting parts in the script. One is the function which reads the historical stock quotes from an Internet server. The other is the one that does the actual prediction. In the following function we see how the quotes are read from the Yahoo server. The kind of data which comes from the server is the CSV format (comma separated values):
Date,Open,High,Low,Close,Volume 9-Oct-00,22.75,22.75,21.375,22.375,7888500 6-Oct-00,23.8125,24.9375,21.5625,22,10701100 5-Oct-00,24.4375,24.625,23.125,23.50,5810300
Lines contain values of the same time instant, whereas columns are
separated by commas and contain the kind of data which is described
in the header (first) line. At first, gawk is instructed to
separate columns by commas (FS = ","). In the loop that follows,
a connection to the Yahoo server is first opened, then a download takes
place, and finally it is closed. All this happens once for each ticker
symbol. In the body of this loop, an Internet address is built up as a
string according to the rules of the Yahoo server. The starting and
ending date are chosen to be exactly the same, but one year apart in
the past. All the action is initiated within the printf command
which transmits the request for data to the Yahoo server.
In the inner loop, the server's data is first read and then scanned
line by line. Only line which have six columns and the name of a month
in the first column contain relevant data, which is stored. Storage
takes place in a two dimensional array (quote); one dimension
being time, the other being the ticker symbol. During retrieval of the
first stock's data, the calendar names of the time instances are stored
in an array (day) because we need them later.
function ReadQuotes() {
# Retrieve historical data for each ticker symbol
FS = ","
for (stock = 1; stock <= StockCount; stock++) {
URL = "http://chart.yahoo.com/table.csv?s=" name[stock] \
"&a=" month "&b=" day "&c=" year-1 \
"&d=" month "&e=" day "&f=" year \
"g=d&q=q&y=0&z=" name[stock] "&x=.csv"
printf "GET " URL " HTTP/1.0\r\n\r\n" |& YahooData
while ((YahooData |& getline) > 0) {
if (NF == 6 && $1 ~ /Jan|Feb|Mar|Apr|May|Jun|Jul|Aug|Sep|Oct|Nov|Dec/) {
if (stock == 1)
days[++daycount] = $1;
quote[$1,stock] = $5
}
}
close(YahooData)
}
FS = " "
}
Now that we have the data, we check it once again to make sure that not a single quote is missing or invalid and all the quotes are aligned correctly. Furthermore, we renumber the time instances. The most recent day gets day number 1 and all other days get consecutive numbers. All quotes are rounded toward the nearest whole number in US Dollars.
function CleanUp() {
# clean up time series; eliminate incomplete data sets
for (d=1; d<=daycount; d++) {
for (stock=1; stock<=StockCount; stock++)
if (! ((days[d],stock) in quote)) stock = StockCount + 10
if (stock > StockCount + 1) continue
datacount ++
for (stock=1; stock<=StockCount; stock++)
data[datacount,stock] = int(0.5 + quote[days[d],stock])
}
delete quote
delete days
}
Now we have arrived at the second really interesting part of the whole affair.
What we present here is a very primitive prediction algorithm:
If a stock fell yesterday, assume it will also fall today; if
it rose yesterday, assume it will rise today. Feel free to replace this
algorithm with a smarter one. If a stock changed in the same direction
on two consecutive days, this is an indication which should be highlighted.
Two-day advances are stored in hot and two-day declines in
avoid.
The rest of the function is a sanity check. It counts the number of correct predictions in relation to the total number of predictions one could have made in the year before.
function Prediction() {
# Predict each ticker symbol by prolonging yesterday's trend
for (stock = 1; stock <= StockCount; stock++) {
if (data[1,stock] > data[2,stock]) {
predict[stock] = "up"
} else if (data[1,stock] < data[2,stock]) {
predict[stock] = "down"
} else {
predict[stock] = "neutral"
}
if ((data[1,stock] > data[2,stock]) && (data[2,stock] > data[3,stock]))
hot[stock] = 1
if ((data[1,stock] < data[2,stock]) && (data[2,stock] < data[3,stock]))
avoid[stock] = 1
}
# Do a plausibility check: how many predictions proved correct?
for (s = 1; s <= StockCount; s++) {
for (d = 1; d <= datacount-2; d++) {
if (data[d+1,s] > data[d+2,s]) {
UpCount++
} else if (data[d+1,s] < data[d+2,s]) {
DownCount++
} else {
NeutralCount++
}
if (((data[d,s] > data[d+1,s]) && (data[d+1,s] > data[d+2,s])) ||
((data[d,s] < data[d+1,s]) && (data[d+1,s] < data[d+2,s])) ||
((data[d,s] == data[d+1,s]) && (data[d+1,s] == data[d+2,s])))
CorrectCount++
}
}
}
At this point the hard work has been done: the array predict
contains the predictions for all the ticker symbols. It is up to the
function Report to find some nice words to introduce the
desired information.
function Report() {
# Generate report
report = "\nThis is your daily "
report = report "stock market report for "strftime("%A, %B %d, %Y")".\n"
report = report "Here are the predictions for today:\n\n"
for (stock = 1; stock <= StockCount; stock++)
report = report "\t" name[stock] "\t" predict[stock] "\n"
for (stock in hot) {
if (HotCount++ == 0)
report = report "\nThe most promising shares for today are these:\n\n"
report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \
tolower(substr(name[stock],1,1)) "/" tolower(name[stock]) ".html\n"
}
for (stock in avoid) {
if (AvoidCount++ == 0)
report = report "\nThe stock shares to avoid today are these:\n\n"
report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \
tolower(substr(name[stock],1,1)) "/" tolower(name[stock]) ".html\n"
}
report = report "\nThis sums up to " HotCount+0 " winners and " AvoidCount+0
report = report " losers. When using this kind\nof prediction scheme for"
report = report " the 12 months which lie behind us,\nwe get " UpCount
report = report " 'ups' and " DownCount " 'downs' and " NeutralCount
report = report " 'neutrals'. Of all\nthese " UpCount+DownCount+NeutralCount
report = report " predictions " CorrectCount " proved correct next day.\n"
report = report "A success rate of "\
int(100*CorrectCount/(UpCount+DownCount+NeutralCount)) "%.\n"
report = report "Random choice would have produced a 33% success rate.\n"
report = report "Disclaimer: Like every other prediction of the stock\n"
report = report "market, this report is, of course, complete nonsense.\n"
report = report "If you are stupid enough to believe these predictions\n"
report = report "you should visit a doctor who can treat your ailment."
}
The function SendMail goes through the list of customers and opens
a pipe to the mail command for each of them. Each one receives an
email with a proper subject heading and is addressed with his full name.
function SendMail() {
# send report to customers
customer["uncle.scrooge@ducktown.gov"] = "Uncle Scrooge"
customer["more@utopia.org" ] = "Sir Thomas More"
customer["spinoza@denhaag.nl" ] = "Baruch de Spinoza"
customer["marx@highgate.uk" ] = "Karl Marx"
customer["keynes@the.long.run" ] = "John Maynard Keynes"
customer["bierce@devil.hell.org" ] = "Ambrose Bierce"
customer["laplace@paris.fr" ] = "Pierre Simon de Laplace"
for (c in customer) {
MailPipe = "mail -s 'Daily Stock Prediction Newsletter'" c
print "Good morning " customer[c] "," | MailPipe
print report "\n.\n" | MailPipe
close(MailPipe)
}
}
If you run the script by hand, you should be patient.
Retrieving the data for all ticker symbols and sending the emails
may take several minutes to complete, depending upon network traffic
and the speed of your Internet link. You will probably be disappointed
by the quality of the prediction algorithm. Try to find a better one.
Should you find one with a success rate of more than 50%, please tell
us about it! It is only for the sake of curiosity, of course. :-)
Let us give you one final indication as to what one can expect from a prediction of stock data, which is sometimes said to contain much randomness. One theory says that all relevant information to be taken into account when estimating the price of a stock is contained in the stock quotes. Every bit of useful information has influenced the fair price. Therefore (the theory says) temporary changes (i.e. fluctuations within a minute) have to be purely random. But what is the cause of short-term changes in stock prices?
Stock prices are fixed when supply and demand meet each other. What people are willing to pay reflects human expectations. Human expectations are not necessarily random. On the Internet, you can find an elucidating paper about predictability and human expectations: Reflections on "Universal Prediction of Individual Sequences" The authors (Feder, Merhav, Gutman) introduce the reader to the subject by telling a thrilling anecdote.
In the early 50's, at Bell Laboratories, David Hagelbarger built a simple "mind reading" machine, whose purpose was to play the "penny matching" game. In this game, a player chooses head or tail, while a "mind reading" machine tries to predict and match his choice. Surprisingly, as Robert Lucky tells in his book "Silicon Dreams", Hagelbarger's simple, 8-state machine, was able to match the "pennies" of its human opponent 5,218 times over the course of 9,795 plays. Random guessing would lead to such a high success rate with a probability less than one out of 10 billion! Shannon, who was interested in prediction, information, and thinking machines, closely followed Hagelbarger's machine, and eventually built his own stripped-down version of the machine, having the same states, but one that used a simpler strategy at each state. As the legend goes, in a duel between the two machines, Shannon's machine won by a slight margin! No one knows if this was due to a superior algorithm or just a chance happening associated with the specific sequence at that game. In any event, the success of both these machines against "untrained" human opponents was explained by the fact that the human opponents cannot draw completely random bits.
Hoare's Law of Large Problems: Inside every large problem is a small problem struggling to get out.
Yahoo's database of stock market data is just one among the many large databases on the Internet. Another one is located at NCBI (National Center for Biotechnology Information). Established in 1988 as a national resource for molecular biology information, NCBI creates public databases, conducts research in computational biology, develops software tools for analyzing genome data, and disseminates biomedical information. In this section, we will have a look at one of NCBI's public services, which is called BLAST (Basic Local Alignment Search Tool).
You probably know that the information necessary for reproducing living cells is encoded in the genetic code of the cells. The genetic material is a very long chain of four base nucleotides. It is the order of appearance (the sequence) of nucleotides which contains the information about the substance to be produced. Scientists in biotechnology often find a specific fragment, determine the nucleotide sequence, and need to know where the sequence at hand comes from. This is where the large databases enter the game. At NCBI, databases store the knowledge about which sequences have ever been found and where they have been found. When the scientist sends his sequence to the BLAST service, the server will look for regions of genetic material in its database which look the most similar to the delivered nucleotide sequence. After a search time of some seconds or minutes the server sends an answer to the scientist. In order to make access simple, NCBI chose to offer their database service through popular Internet protocols. There are four basic ways to use the so called BLAST services:
README file demonstrate how to access this URL.
blastcl3 is the standard network BLAST client.
You can download blastcl3 from the
anonymous FTP location.
Our starting point is the demonstration client mentioned in the first option.
The README file that comes along with the client explains the whole
process in a nutshell. In the rest of this section, we will first see
what such requests look like. Then we will see how to use gawk to
implement a client in about 10 lines of code. Finally, we will see how to
interpret the result returned from the service.
Sequences are expected to be represented in the standard
IUB/IUPAC amino acid and nucleic acid codes,
with these exceptions: lower-case letters are accepted and are mapped
into upper-case; a single hyphen or dash can be used to represent a gap
of indeterminate length; and in amino acid sequences, U and *
are acceptable letters (see below). Before submitting a request, any numerical
digits in the query sequence should either be removed or replaced by
appropriate letter codes (e.g., N for unknown nucleic acid residue
or X for unknown amino acid residue).
The nucleic acid codes supported are:
A --> adenosine M --> A C (amino)
C --> cytidine S --> G C (strong)
G --> guanine W --> A T (weak)
T --> thymidine B --> G T C
U --> uridine D --> G A T
R --> G A (purine) H --> A C T
Y --> T C (pyrimidine) V --> G C A
K --> G T (keto) N --> A G C T (any)
- gap of indeterminate length
Now you know the alphabet of nucleotide sequences. In the last two lines
of the example query below you can see such a sequence, which is obviously
made up only of elements of the alphabet just described. Store this example
query into a file named protbase.request. You are now ready to send
it to the server with the demonstration client.
PROGRAM blastn DATALIB month EXPECT 0.75 BEGIN >GAWK310 the gawking gene GNU AWK tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat caccaccatggacagcaaa
The actual search request begins with the mandatory parameter PROGRAM
in the first column followed by the value blastn (the name of the
program) for searching nucleic acids. The next line contains the mandatory
search parameter DATALIB with the value month for the newest
nucleic acid sequences. The third line contains an optional EXPECT
parameter and the value desired for it. The fourth line contains the
mandatory BEGIN directive, followed by the query sequence in
FASTA/Pearson format.
Each line of information must be less than 80 characters in length.
The "month" database contains all new or revised sequences released in the
last 30 days and is useful for searching against new sequences.
There are five different blast programs, blastn being the one that
compares a nucleotide query sequence against a nucleotide sequence database.
The last server directive that must appear in every request is the
BEGIN directive. The query sequence should immediately follow the
BEGIN directive and must appear in FASTA/Pearson format.
A sequence in
FASTA/Pearson format begins with a single-line description.
The description line, which is required, is distinguished from the lines of
sequence data that follow it by having a greater-than (>) symbol
in the first column. For the purposes of the BLAST server, the text of
the description is arbitrary.
If you prefer to use a client written in gawk, just store the following
10 lines of code into a file named protbase.awk and use this client
instead. Invoke it with gawk -f protbase.awk protbase.request.
Then wait a minute and watch the result coming in. In order to replicate
the demonstration client's behaviour as closely as possible, this client
does not use a proxy server. We could also have extended the client program
in Retrieving Web Pages, to implement the client request from
protbase.awk as a special case.
{ request = request "\n" $0 }
END {
BLASTService = "/inet/tcp/0/www.ncbi.nlm.nih.gov/80"
printf "POST /cgi-bin/BLAST/nph-blast_report HTTP/1.0\n" |& BLASTService
printf "Content-Length: " length(request) "\n\n" |& BLASTService
printf request |& BLASTService
while ((BLASTService |& getline) > 0)
print $0
close(BLASTService)
}
The demonstration client from NCBI is 214 lines long (written in C) and it is not immediately obvious what it does. Our client is so short that it is obvious what it does. First it loops over all lines of the query and stores the whole query into a variable. Then the script establishes an Internet connection to the NCBI server and transmits the query by framing it with a proper HTTP request. Finally it receives and prints the complete result coming from the server.
Now, let us look at the result. It begins with an HTTP header, which you can ignore. Then there are some comments about the query having been filtered to avoid spuriously high scores. After this, there is a reference to the paper that describes the software being used for searching the data base. After a repitition of the original query's description we find the list of significant alignments.
Sequences producing significant alignments: (bits) Value gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733... 38 0.20 gb|AC021056.12|AC021056 Homo sapiens chromosome 3 clone RP11-115... 38 0.20 emb|AL160278.10|AL160278 Homo sapiens chromosome 9 clone RP11-57... 38 0.20 emb|AL391139.11|AL391139 Homo sapiens chromosome X clone RP11-35... 38 0.20 emb|AL365192.6|AL365192 Homo sapiens chromosome 6 clone RP3-421H... 38 0.20 emb|AL138812.9|AL138812 Homo sapiens chromosome 11 clone RP1-276... 38 0.20 gb|AC073881.3|AC073881 Homo sapiens chromosome 15 clone CTD-2169... 38 0.20
This means that the query sequence was found in seven human chromosomes. But the value 0.20 (20%) means that the probability of an accidental match is rather high (20%) in all cases and should be taken into account. You may wonder what the first column means. It is a key to the specific database in which this occurence was found. The unique sequence identifiers reported in the search results can be used as sequence retrieval keys via the NCBI server. The syntax of sequence header lines used by the NCBI BLAST server depends on the database from which each sequence was obtained. The table below lists the identifiers for the databases from which the sequences were derived.
| GenBank | gb|accession|locus
|
| EMBL Data Library | emb|accession|locus
|
| DDBJ, DNA Database of Japan | dbj|accession|locus
|
| NBRF PIR | pir||entry
|
| Protein Research Foundation | prf||name
|
| SWISS-PROT | sp|accession|entry name
|
| Brookhaven Protein Data Bank | pdb|entry|chain
|
| Kabat's Sequences of Immuno... | gnl|kabat|identifier
|
| Patents | pat|country|number
|
| GenInfo Backbone Id | bbs|number
|
For example, an identifier might be gb|AC021182.14|AC021182, where the
gb tag indicates that the identifier refers to a GenBank sequence,
AC021182.14 is its GenBank ACCESSION, and AC021182 is the GenBank LOCUS.
The identifier contains no spaces, so that a space indicates the end of the
identifier.
Let us go on in the result listing. Each of the seven alignments mentioned above is subsequently described in detail. We will have a closer look at the first of them.
>gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733N23, WORKING DRAFT SEQUENCE, 4
unordered pieces
Length = 176383
Score = 38.2 bits (19), Expect = 0.20
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 35 tggtgaagtgtgtttcttg 53
|||||||||||||||||||
Sbjct: 69786 tggtgaagtgtgtttcttg 69804
This alignment was located on the human chromosome 7. The fragment on which part of the query was found had a total length of 176383. Only 19 of the nucleotides matched and the matching sequence ran from character 35 to 53 in the query sequence and from 69786 to 69804 in the fragment on chromosome 7. If you are still reading at this point, you are probably interested in finding out more about Computational Biology and you might appreciate the following hints.
gawk to prevail over heretical abnormalities such as perl,
tcl, or python which are not even proper sequences.
HTTP is like being married: you have to be able to handle whatever you're given, while being very careful what you send back. Phil Smith III, http://www.netfunny.com/rhf/jokes/99/Mar/http.html
In A Web Service with Interaction,
we saw the function CGI_setup as part of the web server
"core logic" framework. The code presented there handles almost
everything necessary for CGI requests.
One thing it doesn't do is handle encoded characters in the requests.
For example, an & is encoded as a percent sign followed by
the hexadecimal value, %26. These encoded values should be
decoded.
Below is a simple library to do these tasks.
This code is used for all web server examples
used throughout this web page.
If you want to use it for your own web server, store the source code
into a file named inetlib.awk. Then you can include
these functions into your code by writing
@include inetlib.awk
into the first line of your script. But beware, this mechanism is
only possible if you invoke your web server script with igawk
instead of the usual awk or gawk.
Here is the code:
# core of a web server
# optional variable MyHost contains host address
# optional variable MyPort contains port number
# needs Status, Reason, Header, Document, Footer
# sets MyPrefix, HttpService
#
BEGIN {
if (MyHost == "") {
"uname -n" | getline MyHost
close("uname -n")
}
if (MyPort == 0) MyPort = 8080
HttpService = "/inet/tcp/" MyPort "/0/0"
MyPrefix = "http://" MyHost ":" MyPort
SetUpServer()
while ("Perl" != "elegant") {
RS = ORS = "\r\n" # header lines are terminated this way
Status = 200 # this means OK
Reason = "OK"
Header = TopHeader
Document = TopDoc
Footer = TopFooter
if (GETARG["Method"] == "GET") { HandleGET()
} else if (GETARG["Method"] == "HEAD") { # not yet implemented
} else if (GETARG["Method"] != "") { print "bad method", GETARG["Method"]
}
Prompt = Header Document Footer
print "HTTP/1.0", Status, Reason |& HttpService
print "Connection: Close" |& HttpService
print "Pragma: no-cache" |& HttpService
print "Content-length:", length(Prompt) + length(ORS) |& HttpService
print ORS Prompt |& HttpService
while ((HttpService |& getline) > 0) ; # ignore all the header lines
close(HttpService) # stop talking to this client
HttpService |& getline # wait for new client request
print systime(), strftime(), $0 # do some logging
CGI_setup($1, $2, $3)
}
}
# CGI Libary
#
# Arnold Robbins, arnold@gnu.org
# based on work by Juergen Kahrs, Juergen.Kahrs@vr-web.de
# September 2000
# Global arrays
# GETARG --- arguments to CGI GET command
# MENU --- menu items (path names)
# PARAM --- parameters of form x=y
function CGI_setup( method, uri, version, i)
{
delete GETARG
delete MENU
delete PARAM
GETARG["Method"] = method
GETARG["URI"] = uri
GETARG["Version"] = version
i = index(uri, "?")
if (i > 0) { # is there a "?" indicating a CGI request?
split(substr(uri, 1, i-1), MENU, "[/:]")
split(substr(uri, i+1), PARAM, "&")
for (i in PARAM) {
PARAM[i] = _CGI_decode(PARAM[i])
j = index(PARAM[i], "=")
GETARG[substr(PARAM[i], 1, j-1)] = substr(PARAM[i], j+1)
}
} else { # there is no "?", no need for splitting PARAMs
split(uri, MENU, "[/:]")
}
for (i in MENU) # decode characters in path
if (i > 4) # but not those in host name
MENU[i] = _CGI_decode(MENU[i])
}
What this accomplishes for us is to isolate details in a
single function, CGI_setup. Decoding of encoded characters is pushed
off to a helper function, _CGI_decode. The use of the leading _
in the function name is intended to indicate that it is an "internal" function,
although there is nothing to enforce this.
function _CGI_decode(str, hexdigs, i, pre, code1, code2, val, result)
{
hexdigs = "123456789abcdef"
i = index(str, "%")
if (i == 0) # no work to do
return str
do {
pre = substr(str, 1, i-1) # part before %xx
code1 = substr(str, i+1, 1) # first hex digit
code2 = substr(str, i+2, 1) # second hex digit
str = substr(str, i+3) # rest of string
code1 = tolower(code1)
code2 = tolower(code2)
val = index(hexdigs, code1) * 16 \
+ index(hexdigs, code2)
result = result pre sprintf("%c", val)
i = index(str, "%")
} while (i != 0)
if (length(str) > 0)
result = result str
return result
}
This works by splitting the string apart around an encoded character.
The two digits are converted to lower case and looked up in a string
of hex digits. Note that 0 is not in the string on purpose;
index will return zero when it's not found, automatically giving
the correct value! Once the hexadecimal value is converted from
characters in a string into a numerical value, sprintf
converts the value back into a real character.
Here is a simple test harness for the above functions.
BEGIN {
CGI_setup("GET",
"http://www.gnu.org/cgi-bin/foo?p1=stuff&p2=stuff%26junk&percent=a %25 sign",
"1.0")
for (i in MENU)
printf "MENU[\"%s\"] = %s\n", i, MENU[i]
for (i in PARAM)
printf "PARAM[\"%s\"] = %s\n", i, PARAM[i]
for (i in GETARG)
printf "GETARG[\"%s\"] = %s\n", i, GETARG[i]
}
Here is what happens when we run it:
$ gawk -f testserv.awk -| MENU["4"] = www.gnu.org -| MENU["5"] = cgi-bin -| MENU["6"] = foo -| MENU["1"] = http -| MENU["2"] = -| MENU["3"] = -| PARAM["1"] = p1=stuff -| PARAM["2"] = p2=stuff&junk -| PARAM["3"] = percent=a % sign -| GETARG["p1"] = stuff -| GETARG["percent"] = a % sign -| GETARG["p2"] = stuff&junk -| GETARG["Method"] = GET -| GETARG["Version"] = 1.0 -| GETARG["URI"] = http://www.gnu.org/cgi-bin/foo?p1=stuff&p2=stuff%26junk&percent=a %25 sign
Version 1.1, March 2000
Copyright (C) 2000 Free Software Foundation, Inc. 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA Everyone is permitted to copy and distribute verbatim copies of this license document, but changing it is not allowed.
The purpose of this License is to make a manual, textbook, or other written document "free" in the sense of freedom: to assure everyone the effective freedom to copy and redistribute it, with or without modifying it, either commercially or noncommercially. Secondarily, this License preserves for the author and publisher a way to get credit for their work, while not being considered responsible for modifications made by others.
This License is a kind of "copyleft", which means that derivative works of the document must themselves be free in the same sense. It complements the GNU General Public License, which is a copyleft license designed for free software.
We have designed this License in order to use it for manuals for free
software, because free software needs free documentation: a free
program should come with manuals providing the same freedoms that the
software does. But this License is not limited to software manuals;
it can be used for any textual work, regardless of subject matter or
whether it is published as a printed book. We recommend this License
principally for works whose purpose is instruction or reference.
This License applies to any manual or other work that contains a notice placed by the copyright holder saying it can be distributed under the terms of this License. The "Document", below, refers to any such manual or work. Any member of the public is a licensee, and is addressed as "you".
A "Modified Version" of the Document means any work containing the Document or a portion of it, either copied verbatim, or with modifications and/or translated into another language.
A "Secondary Section" is a named appendix or a front-matter section of the Document that deals exclusively with the relationship of the publishers or authors of the Document to the Document's overall subject (or to related matters) and contains nothing that could fall directly within that overall subject. (For example, if the Document is in part a textbook of mathematics, a Secondary Section may not explain any mathematics.) The relationship could be a matter of historical connection with the subject or with related matters, or of legal, commercial, philosophical, ethical or political position regarding them.
The "Invariant Sections" are certain Secondary Sections whose titles are designated, as being those of Invariant Sections, in the notice that says that the Document is released under this License.
The "Cover Texts" are certain short passages of text that are listed, as Front-Cover Texts or Back-Cover Texts, in the notice that says that the Document is released under this License.
A "Transparent" copy of the Document means a machine-readable copy, represented in a format whose specification is available to the general public, whose contents can be viewed and edited directly and straightforwardly with generic text editors or (for images composed of pixels) generic paint programs or (for drawings) some widely available drawing editor, and that is suitable for input to text formatters or for automatic translation to a variety of formats suitable for input to text formatters. A copy made in an otherwise Transparent file format whose markup has been designed to thwart or discourage subsequent modification by readers is not Transparent. A copy that is not "Transparent" is called "Opaque".
Examples of suitable formats for Transparent copies include plain ASCII without markup, Texinfo input format, LaTeX input format, SGML or XML using a publicly available DTD, and standard-conforming simple HTML designed for human modification. Opaque formats include PostScript, PDF, proprietary formats that can be read and edited only by proprietary word processors, SGML or XML for which the DTD and/or processing tools are not generally available, and the machine-generated HTML produced by some word processors for output purposes only.
The "Title Page" means, for a printed book, the title page itself,
plus such following pages as are needed to hold, legibly, the material
this License requires to appear in the title page. For works in
formats which do not have any title page as such, "Title Page" means
the text near the most prominent appearance of the work's title,
preceding the beginning of the body of the text.
You may copy and distribute the Document in any medium, either commercially or noncommercially, provided that this License, the copyright notices, and the license notice saying this License applies to the Document are reproduced in all copies, and that you add no other conditions whatsoever to those of this License. You may not use technical measures to obstruct or control the reading or further copying of the copies you make or distribute. However, you may accept compensation in exchange for copies. If you distribute a large enough number of copies you must also follow the conditions in section 3.
You may also lend copies, under the same conditions stated above, and
you may publicly display copies.
If you publish printed copies of the Document numbering more than 100, and the Document's license notice requires Cover Texts, you must enclose the copies in covers that carry, clearly and legibly, all these Cover Texts: Front-Cover Texts on the front cover, and Back-Cover Texts on the back cover. Both covers must also clearly and legibly identify you as the publisher of these copies. The front cover must present the full title with all words of the title equally prominent and visible. You may add other material on the covers in addition. Copying with changes limited to the covers, as long as they preserve the title of the Document and satisfy these conditions, can be treated as verbatim copying in other respects.
If the required texts for either cover are too voluminous to fit legibly, you should put the first ones listed (as many as fit reasonably) on the actual cover, and continue the rest onto adjacent pages.
If you publish or distribute Opaque copies of the Document numbering more than 100, you must either include a machine-readable Transparent copy along with each Opaque copy, or state in or with each Opaque copy a publicly-accessible computer-network location containing a complete Transparent copy of the Document, free of added material, which the general network-using public has access to download anonymously at no charge using public-standard network protocols. If you use the latter option, you must take reasonably prudent steps, when you begin distribution of Opaque copies in quantity, to ensure that this Transparent copy will remain thus accessible at the stated location until at least one year after the last time you distribute an Opaque copy (directly or through your agents or retailers) of that edition to the public.
It is requested, but not required, that you contact the authors of the
Document well before redistributing any large number of copies, to give
them a chance to provide you with an updated version of the Document.
You may copy and distribute a Modified Version of the Document under the conditions of sections 2 and 3 above, provided that you release the Modified Version under precisely this License, with the Modified Version filling the role of the Document, thus licensing distribution and modification of the Modified Version to whoever possesses a copy of it. In addition, you must do these things in the Modified Version:
If the Modified Version includes new front-matter sections or appendices that qualify as Secondary Sections and contain no material copied from the Document, you may at your option designate some or all of these sections as invariant. To do this, add their titles to the list of Invariant Sections in the Modified Version's license notice. These titles must be distinct from any other section titles.
You may add a section entitled "Endorsements", provided it contains nothing but endorsements of your Modified Version by various parties-for example, statements of peer review or that the text has been approved by an organization as the authoritative definition of a standard.
You may add a passage of up to five words as a Front-Cover Text, and a passage of up to 25 words as a Back-Cover Text, to the end of the list of Cover Texts in the Modified Version. Only one passage of Front-Cover Text and one of Back-Cover Text may be added by (or through arrangements made by) any one entity. If the Document already includes a cover text for the same cover, previously added by you or by arrangement made by the same entity you are acting on behalf of, you may not add another; but you may replace the old one, on explicit permission from the previous publisher that added the old one.
The author(s) and publisher(s) of the Document do not by this License
give permission to use their names for publicity for or to assert or
imply endorsement of any Modified Version.
You may combine the Document with other documents released under this License, under the terms defined in section 4 above for modified versions, provided that you include in the combination all of the Invariant Sections of all of the original documents, unmodified, and list them all as Invariant Sections of your combined work in its license notice.
The combined work need only contain one copy of this License, and multiple identical Invariant Sections may be replaced with a single copy. If there are multiple Invariant Sections with the same name but different contents, make the title of each such section unique by adding at the end of it, in parentheses, the name of the original author or publisher of that section if known, or else a unique number. Make the same adjustment to the section titles in the list of Invariant Sections in the license notice of the combined work.
In the combination, you must combine any sections entitled "History"
in the various original documents, forming one section entitled
"History"; likewise combine any sections entitled "Acknowledgements",
and any sections entitled "Dedications". You must delete all sections
entitled "Endorsements."
You may make a collection consisting of the Document and other documents released under this License, and replace the individual copies of this License in the various documents with a single copy that is included in the collection, provided that you follow the rules of this License for verbatim copying of each of the documents in all other respects.
You may extract a single document from such a collection, and distribute
it individually under this License, provided you insert a copy of this
License into the extracted document, and follow this License in all
other respects regarding verbatim copying of that document.
A compilation of the Document or its derivatives with other separate and independent documents or works, in or on a volume of a storage or distribution medium, does not as a whole count as a Modified Version of the Document, provided no compilation copyright is claimed for the compilation. Such a compilation is called an "aggregate", and this License does not apply to the other self-contained works thus compiled with the Document, on account of their being thus compiled, if they are not themselves derivative works of the Document.
If the Cover Text requirement of section 3 is applicable to these
copies of the Document, then if the Document is less than one quarter
of the entire aggregate, the Document's Cover Texts may be placed on
covers that surround only the Document within the aggregate.
Otherwise they must appear on covers around the whole aggregate.
Translation is considered a kind of modification, so you may
distribute translations of the Document under the terms of section 4.
Replacing Invariant Sections with translations requires special
permission from their copyright holders, but you may include
translations of some or all Invariant Sections in addition to the
original versions of these Invariant Sections. You may include a
translation of this License provided that you also include the
original English version of this License. In case of a disagreement
between the translation and the original English version of this
License, the original English version will prevail.
You may not copy, modify, sublicense, or distribute the Document except
as expressly provided for under this License. Any other attempt to
copy, modify, sublicense or distribute the Document is void, and will
automatically terminate your rights under this License. However,
parties who have received copies, or rights, from you under this
License will not have their licenses terminated so long as such
parties remain in full compliance.
The Free Software Foundation may publish new, revised versions of the GNU Free Documentation License from time to time. Such new versions will be similar in spirit to the present version, but may differ in detail to address new problems or concerns. See http://www.gnu.org/copyleft/.
Each version of the License is given a distinguishing version number. If the Document specifies that a particular numbered version of this License "or any later version" applies to it, you have the option of following the terms and conditions either of that specified version or of any later version that has been published (not as a draft) by the Free Software Foundation. If the Document does not specify a version number of this License, you may choose any version ever published (not as a draft) by the Free Software Foundation.
To use this License in a document you have written, include a copy of the License in the document and put the following copyright and license notices just after the title page:
Copyright (C) year your name. Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation License, Version 1.1 or any later version published by the Free Software Foundation; with the Invariant Sections being list their titles, with the Front-Cover Texts being list, and with the Back-Cover Texts being list. A copy of the license is included in the section entitled ``GNU Free Documentation License''.If you have no Invariant Sections, write "with no Invariant Sections" instead of saying which ones are invariant. If you have no Front-Cover Texts, write "no Front-Cover Texts" instead of "Front-Cover Texts being list"; likewise for Back-Cover Texts.
If your document contains nontrivial examples of program code, we recommend releasing these examples in parallel under your choice of free software license, such as the GNU General Public License, to permit their use in free software.
/inet/raw: Using Networking, File /inet/raw
/inet/tcp: Using Networking, File /inet/tcp
/inet/udp: Using Networking, File /inet/udp
cron: STOXPRED
finger: Setting Up, Interacting
getline: TCP Connecting
gif image format: STATIST, Web page
png image format: STATIST, Web page
ps image format: STATIST
xbm image format: Interacting Service
|& operator: TCP Connecting
It should be noted that although the Internet seems to have conquered the world, there are other networking protocol suites in existence and in use.
In the days before voice mail systems!
This special file is reserved, but not otherwise currently implemented.
This special file is reserved, but not otherwise currently implemented.
HTTP 1.1 was initially specified in RFC 2068. In June 1999 RFC 2068 was obsoleted by RFC 2616. It is an update without any substantial changes.
Due to licensing problems, the default
installation of GNUPLOT has the generation of .gif files switched
off. If your installed version does not accept set term gif,
just download and install the most recent version of GNUPLOT and the
GD library
by Thomas Boutell.
Otherwise you still have the chance to generate some
ASCII-art style images with GNUPLOT by using set term dumb.
(We tried it and it worked.)